WormMine: Gene WBGene00138707

• WormBase Gene ID: WBGene00138707
• Gene Name: CJA19502
• Sequence Name: CJA19502
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable fatty acid elongase activity. Predicted to be located in membrane. Is an ortholog of C. elegans elo-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA19502a.1	CJA19502a.1		[unknown]
Transcript:CJA19502a.2	CJA19502a.2		[unknown]
Transcript:CJA19502b.1	CJA19502b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA19502b	CJA19502b		[unknown]
CDS:CJA19502a	CJA19502a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075169
• Remark: CJA19502, GTATTTGCGAGATGACGTTTTGTTCCTGTATCGAAAATTGAAGACTATGAAGCTGGACTA, WBGene00138707
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region