WormMine: Gene WBGene00132058

• WormBase Gene ID: WBGene00132058
• Gene Name: CJA12854
• Sequence Name: CJA12854
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in lipid metabolic process. Is an ortholog of C. elegans F28H7.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12854.1	CJA12854.1		[unknown]
Transcript:CJA12854.6	CJA12854.6		[unknown]
Transcript:CJA12854.5	CJA12854.5		[unknown]
Transcript:CJA12854.4	CJA12854.4		[unknown]
Transcript:CJA12854.3	CJA12854.3		[unknown]
Transcript:CJA12854.2	CJA12854.2		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12854	CJA12854		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081220
• Remark: CJA08454, TGCCACACGTGCCAAACGAGGGATTCCTTGGATACTATCACAACAAATATGAAGTGTACT, WBGene00127658
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region