WormMine: Gene WBGene00135694

• WormBase Gene ID: WBGene00135694
• Gene Name: CJA16491
• Sequence Name: CJA16491
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable chitinase activity. Predicted to be involved in cell wall macromolecule catabolic process and chitin catabolic process. Is an ortholog of C. elegans cht-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16491.1	CJA16491.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16491	CJA16491		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079525
• Remark: CJA16491, TTGCGAGTATTTACGCGAATCCGTCAATGTACTCACTGGATAACAAAACATCGCCATGTC, WBGene00135694
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region