WormMine: Gene WBGene00175145

• WormBase Gene ID: WBGene00175145
• Gene Name: CJA19574
• Sequence Name: CJA19574
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable nucleic acid binding activity.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA19574a.1	CJA19574a.1		[unknown]
Transcript:CJA19574b.1	CJA19574b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA19574b	CJA19574b		[unknown]
CDS:CJA19574a	CJA19574a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080956
• Remark: CJA19574, GACAAAGGGCAACTTCGTAAAAGGGGGAAGGGGGCGTCCAAAAAGGGGCGTCCAGCCTGC, WBGene00175145
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region