WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00176059 Gene Name  CJA20487
Sequence Name  ? CJA20487 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans skn-1 and sknr-1. In C. elegans, skn-1 is involved in several processes, including endoderm development; positive regulation of macromolecule biosynthetic process; and response to stress. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA20487.1 CJA20487.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA20487 CJA20487   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-skn-1, GCCGTCAACGCAGAACCGATCGTCACGATAAGGTGTTTTCGAGAAACAGCATGTACAACT, WBGene00176059   Expr1083593 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA22415, CGACATGTCACATCCGGACAGCCAGCTGAATCAAATGTTCAACGTCAACAATCCGATTAT, WBGene00177987   Expr1075930 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA23665, CAATTCACCGACTCGCCAAGTCTCGAAGACATGGAGCTCATCGACGTTCTGTGGCGTAGC, WBGene00179237   Expr1078459 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region