WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00176814 Gene Name  CJA21242
Sequence Name  ? CJA21242 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable calcium ion binding activity. Is an ortholog of C. elegans F55H12.3. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA21242a.1 CJA21242a.1   [unknown]
Transcript:CJA21242b.1 CJA21242b.1   [unknown]
Transcript:CJA21242c.1 CJA21242c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA21242c CJA21242c   [unknown]
CDS:CJA21242a CJA21242a   [unknown]
CDS:CJA21242b CJA21242b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA26657, GAACAATCCGTGCCAGCAATCGGGACAGTGCTCGTTCAACTTGACTACAGGCCAACAGAA, WBGene00182229   Expr1084510 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA23234, AAACAAAGTACGCACTTCCAAATTCCTACTGTAAACCGCTGATGAGCCCGCCGACAATCT, WBGene00178806   Expr1091879 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region