WormMine: Gene WBGene00177344

• WormBase Gene ID: WBGene00177344
• Gene Name: Cjp-apc-11
• Sequence Name: CJA21772
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable cullin family protein binding activity; ubiquitin protein ligase activity; and zinc ion binding activity. Predicted to be involved in anaphase-promoting complex-dependent catabolic process. Predicted to be part of anaphase-promoting complex. Is an ortholog of C. elegans apc-11. In C. elegans, apc-11 is involved in anaphase-promoting complex-dependent catabolic process; embryo development; and meiotic chromosome segregation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA21772.1	CJA21772.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA21772	CJA21772		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091696
• Remark: CJA20831, TGCATCGAGAAGTGGATTGCAGCGCCAACAAATCAGCCGAAAGCTCAATGTCCACTGTGT, WBGene00176403
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region