WormMine: Gene WBGene00179164

• WormBase Gene ID: WBGene00179164
• Gene Name: CJA23592
• Sequence Name: CJA23592
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable fatty acid elongase activity. Predicted to be located in membrane. Is an ortholog of C. elegans tsp-12 and members of the C. elegans elo gene class including elo-8. In C. elegans, elo-1 is involved in unsaturated fatty acid biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA23592.1	CJA23592.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA23592	CJA23592		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091673
• Remark: Cjp-elo-3, AGTGTATTTTACGTATTTCCTGCTTTTCGCAAACTTCTTCTACCACGCATACGTCAAGAA, WBGene00136372
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region