WormMine: Gene WBGene00179534

• WormBase Gene ID: WBGene00179534
• Gene Name: Cjp-taf-12.1
• Sequence Name: CJA23962
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable protein heterodimerization activity. Predicted to be involved in DNA-templated transcription initiation. Predicted to be part of SAGA complex and transcription factor TFIID complex. Is an ortholog of C. elegans taf-12.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA23962.1	CJA23962.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA23962	CJA23962		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080414
• Remark: CJA23962, GACCTCTCCAAAGAAAAACACGTCCCCACAGAAGCTCACAAACAGAGATTGGCACTGCTG, WBGene00179534
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region