WormMine: Gene WBGene00180043

• WormBase Gene ID: WBGene00180043
• Gene Name: CJA24471
• Sequence Name: CJA24471
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans T13F2.2. In C. elegans, T13F2.2 is involved in RNA polymerase II promoter clearance.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA24471.1	CJA24471.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA24471	CJA24471		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079780
• Remark: CJA24471, CGGTAAAATCGCGCCAGGGCGCAAGGGCATCTCCATAACAAAGGCTCAGTGGTTGAACTT, WBGene00180043
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region