WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00180258 Gene Name  Cjp-atg-4.2
Sequence Name  ? CJA24686 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable cysteine-type peptidase activity. Is an ortholog of C. elegans atg-4.2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA24686c.1 CJA24686c.1   [unknown]
Transcript:CJA24686a.1 CJA24686a.1   [unknown]
Transcript:CJA24686b.1 CJA24686b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA24686a CJA24686a   [unknown]
CDS:CJA24686b CJA24686b   [unknown]
CDS:CJA24686c CJA24686c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA24686, AAGGGAAAAATGGCCGTCGGTAGTTGGTACAGTCCTTCGGAAGCTGTTTTTATTATGAAG, WBGene00180258   Expr1078670 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-atg-4.2, AATTGAGACGAAAAACTGGATGAAAACCTTGATTTTGGTGGTTGTTGTGAGACTTGGAGC, WBGene00122423   Expr1075346 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region