WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00180381 Gene Name  Cjp-coa-6
Sequence Name  ? CJA24809 Organism  Caenorhabditis japonica
Automated Description  Predicted to be involved in respiratory chain complex IV assembly. Is an ortholog of C. elegans coa-6. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA24809.1 CJA24809.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA24809 CJA24809   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA10902, GATGGCGATTCCACGTGGATTCTTCCGGTTGTCACCATCAAAAATGACCAATATCAAATT, WBGene00130106   Expr1072033 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA13436, CCGACCTCTTGGGTCAACCACTTTATCCGAAAGTACCAATTCGAAAAGTACAAGAAGACG, WBGene00132640   Expr1090815 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA24809, ATTCGCAACGAGGAATCCACCGAAAAGAATACGTGATGACGTTCTGAAGCGATACAATGG, WBGene00180381   Expr1075556 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region