WormMine: Gene WBGene00180539

• WormBase Gene ID: WBGene00180539
• Gene Name: Cjp-hlh-6
• Sequence Name: CJA24967
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable protein dimerization activity. Is an ortholog of C. elegans hlh-6. In C. elegans, hlh-6 is involved in several processes, including nematode pharyngeal gland morphogenesis; pharynx development; and positive regulation of multicellular organismal process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA24967b.1	CJA24967b.1		[unknown]
Transcript:CJA24967a.1	CJA24967a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA24967a	CJA24967a		[unknown]
CDS:CJA24967b	CJA24967b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085491
• Remark: Cjp-hlh-6, TACCAATATTTCCAGAGAAAAACGAATTTCCAAAGTGGACACCTTGCGACTGGCGATTCG, WBGene00180539
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region