WormMine: Gene WBGene00180875

• WormBase Gene ID: WBGene00180875
• Gene Name: CJA25303
• Sequence Name: CJA25303
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable kynureninase activity and pyridoxal phosphate binding activity. Predicted to be involved in NAD biosynthetic process and tryptophan catabolic process. Predicted to be located in cytoplasm. Is an ortholog of C. elegans kynu-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA25303.1	CJA25303.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA25303	CJA25303		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080206
• Remark: CJA25303, GGGACTCATGCCAAAGGCTACCGAAGAAGTTTTGAAGGAGCATCTGGACAAGTGGGCTAA, WBGene00180875
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region