WormMine: Gene WBGene00182051

• WormBase Gene ID: WBGene00182051
• Gene Name: CJA26479
• Sequence Name: CJA26479
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable fatty acyl-CoA hydrolase activity. Predicted to be involved in acyl-CoA metabolic process. Is an ortholog of C. elegans D2021.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA26479d.1	CJA26479d.1		[unknown]
Transcript:CJA26479c.1	CJA26479c.1		[unknown]
Transcript:CJA26479b.1	CJA26479b.1		[unknown]
Transcript:CJA26479a.1	CJA26479a.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA26479d	CJA26479d		[unknown]
CDS:CJA26479a	CJA26479a		[unknown]
CDS:CJA26479b	CJA26479b		[unknown]
CDS:CJA26479c	CJA26479c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078850
• Remark: CJA26479, TCCACGGAGCAATTTTTGATAGCAATAAGAATTGCATAGTTTCATTCGTTCAAGAAGCGT, WBGene00182051
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region