WormMine: Gene WBGene00183280

• WormBase Gene ID: WBGene00183280
• Gene Name: CJA27707
• Sequence Name: CJA27707
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in mitotic chromosome condensation. Is an ortholog of C. elegans hcp-6. In C. elegans, hcp-6 is involved in attachment of mitotic spindle microtubules to kinetochore; embryo development; and mitotic chromosome condensation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA27707.1	CJA27707.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA27707	CJA27707		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090548
• Remark: CJA17945, AGATGGATGAACAAGAACAAGAACAAGATGTGGATCAGGAGAACGCGTCGCGTGGAGTCA, WBGene00137149
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region