WormMine: Gene WBGene00183624

• WormBase Gene ID: WBGene00183624
• Gene Name: CJA28050
• Sequence Name: CJA28050
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable aspartic endopeptidase activity, intramembrane cleaving. Predicted to be involved in protein processing. Predicted to be located in membrane. Is an ortholog of C. elegans sel-12. In C. elegans, sel-12 is involved in several processes, including apical protein localization; egg-laying behavior; and regulation of signal transduction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA28050a.1	CJA28050a.1		[unknown]
Transcript:CJA28050b.1	CJA28050b.1		[unknown]
Transcript:CJA28050c.1	CJA28050c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA28050c	CJA28050c		[unknown]
CDS:CJA28050a	CJA28050a		[unknown]
CDS:CJA28050b	CJA28050b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080043
• Remark: CJA28050, GCGACAAATTACGTTTATGACAGTGGGGAAGACGCGGATGACGATGAATCAACCCAAGAA, WBGene00183624
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region