WormMine: Gene WBGene00176233

• WormBase Gene ID: WBGene00176233
• Gene Name: CJA20661
• Sequence Name: CJA20661
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable calcium ion binding activity. Is an ortholog of C. elegans mua-3. In C. elegans, mua-3 is involved in cell-matrix adhesion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA20661a.1	CJA20661a.1		[unknown]
Transcript:CJA20661c.1	CJA20661c.1		[unknown]
Transcript:CJA20661b.1	CJA20661b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA20661a	CJA20661a		[unknown]
CDS:CJA20661b	CJA20661b		[unknown]
CDS:CJA20661c	CJA20661c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091929
• Remark: CJA20661, GTGCCAGTGTCCAATCAACTCTAAAGATCAGTCGCCAGATCCGAGAAAGCCAGGAAGGCT, WBGene00176233
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region