WormMine: Gene WBGene00207654

• WormBase Gene ID: WBGene00207654
• Gene Name: CJA31807
• Sequence Name: CJA31807
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be a structural constituent of nuclear pore. Predicted to be involved in nucleocytoplasmic transport. Predicted to be part of nuclear pore. Is an ortholog of C. elegans npp-8. In C. elegans, npp-8 is involved in embryo development; nucleus organization; and regulation of exit from mitosis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA31807b.1	CJA31807b.1		[unknown]
Transcript:CJA31807a.1	CJA31807a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA31807a	CJA31807a		[unknown]
CDS:CJA31807b	CJA31807b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085595
• Remark: Cjp-npp-8, AACTCGCTCTATTGCACTGTGCAAATATGTACGTGGAAGAGCACATTTTTGAAACGTGGG, WBGene00129172
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region