WormMine: Gene WBGene00208247

• WormBase Gene ID: WBGene00208247
• Gene Name: Cjp-gpdh-1.4
• Sequence Name: CJA32400
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable NAD binding activity; oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor; and protein homodimerization activity. Predicted to be involved in NADH oxidation; carbohydrate metabolic process; and glycerol-3-phosphate catabolic process. Is an ortholog of C. elegans gpdh-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA32400.1	CJA32400.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA32400	CJA32400		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079065
• Remark: CJA21919, GGAAAAAGAGCTTCTGAACGGACAAAGTGCTCAAGGACCACCAACGGCTCAGGACGTGTT, WBGene00177491
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region