WormMine: Gene WBGene00208872

• WormBase Gene ID: WBGene00208872
• Gene Name: CJA33025
• Sequence Name: CJA33025
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable phosphatase activity. Is an ortholog of C. elegans pgph-1; pgph-2; and pgph-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA33025a.1	CJA33025a.1		[unknown]
Transcript:CJA33025b.1	CJA33025b.1		[unknown]
Transcript:CJA33025c.1	CJA33025c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA33025a	CJA33025a		[unknown]
CDS:CJA33025b	CJA33025b		[unknown]
CDS:CJA33025c	CJA33025c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088024
• Remark: CJA27920, AACTTTGTTGGTGCTGTCTGGCTGCCATCAAATCGAAGATATCATTGAGAACCAGATGAA, WBGene00183493
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region