WormMine: Gene WBGene00209515

• WormBase Gene ID: WBGene00209515
• Gene Name: CJA33668
• Sequence Name: CJA33668
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA binding activity. Is an ortholog of C. elegans appg-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA33668d.1	CJA33668d.1		[unknown]
Transcript:CJA33668c.1	CJA33668c.1		[unknown]
Transcript:CJA33668b.1	CJA33668b.1		[unknown]
Transcript:CJA33668a.1	CJA33668a.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA33668d	CJA33668d		[unknown]
CDS:CJA33668c	CJA33668c		[unknown]
CDS:CJA33668b	CJA33668b		[unknown]
CDS:CJA33668a	CJA33668a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081729
• Remark: CJA13864, AATCCCAATGTCCTACAGTATCATGTGAGGACGCTTGTCAAACAGTGTGCAAGGGACAAT, WBGene00133068
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region