WormMine: Gene WBGene00210973

• WormBase Gene ID: WBGene00210973
• Gene Name: Cjp-pptr-1.9
• Sequence Name: CJA35126
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable protein phosphatase regulator activity. Predicted to be involved in signal transduction. Predicted to be part of protein phosphatase type 2A complex. Is an ortholog of C. elegans pptr-1. In C. elegans, pptr-1 is involved in several processes, including P granule assembly; determination of adult lifespan; and negative regulation of insulin receptor signaling pathway.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA35126b.1	CJA35126b.1		[unknown]
Transcript:CJA35126a.1	CJA35126a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA35126b	CJA35126b		[unknown]
CDS:CJA35126a	CJA35126a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084149
• Remark: CJA13344, GATTTGCTCTTCCGTTAAAGCAAGAGCACAAGATGTTCCTCGTCAAAGTACTCCTTCCAC, WBGene00132548
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region