WormMine: Gene WBGene00211709

• WormBase Gene ID: WBGene00211709
• Gene Name: CJA35862
• Sequence Name: CJA35862
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity; DNA binding activity; and DNA helicase activity. Predicted to be involved in DNA duplex unwinding and DNA replication initiation. Predicted to be part of MCM complex. Is an ortholog of C. elegans mcm-4. In C. elegans, mcm-4 is involved in gonad development; locomotion; and nervous system development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA35862.1	CJA35862.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA35862	CJA35862		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070762
• Remark: Cjp-mcm-4, GCTCTTCACTTCAGAAAAATGGACACATCGCGTCTTCATCAGGACAATGGAGAGACACTC, WBGene00119809
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region