WormMine: Gene WBGene00211817

• WormBase Gene ID: WBGene00211817
• Gene Name: Cjp-lin-28
• Sequence Name: CJA35970
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable nucleic acid binding activity and zinc ion binding activity. Is an ortholog of C. elegans lin-28. In C. elegans, lin-28 is involved in several processes, including regulation of cell fate specification; regulation of development, heterochronic; and regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA35970.1	CJA35970.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA35970	CJA35970		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1087359
• Remark: Cjp-lin-28, AAAGCATCGTCCGGAACAAGTGGCAGCCGAAGAGGCGGAAGCGGAAGCGGCAAGAGCGGC, WBGene00133500
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region