WormMine: Gene WBGene00213204

• WormBase Gene ID: WBGene00213204
• Gene Name: CJA37357
• Sequence Name: CJA37357
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable dynein intermediate chain binding activity; dynein light intermediate chain binding activity; and minus-end-directed microtubule motor activity. Predicted to be involved in microtubule-based movement. Predicted to be part of dynein complex. Is an ortholog of C. elegans che-3. In C. elegans, che-3 is involved in several processes, including dauer entry; non-motile cilium assembly; and positive regulation of dauer larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA37357.1	CJA37357.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA37357	CJA37357		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072360
• Remark: Cjp-che-3, TCAATGGAGAGCAGATACAAGTACCACTATACAGTTCAAACGATCGTTCGGATTTGGTCA, WBGene00121012
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region