WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00214732 Gene Name  Cjp-ncr-2
Sequence Name  ? CJA38885 Organism  Caenorhabditis japonica
Automated Description  Predicted to be located in membrane. Is an ortholog of C. elegans ncr-2. In C. elegans, ncr-2 is involved in cholesterol homeostasis; cholesterol transport; and nematode larval development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA38885a.1 CJA38885a.1   [unknown]
Transcript:CJA38885b.1 CJA38885b.1   [unknown]
Transcript:CJA38885c.1 CJA38885c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA38885c CJA38885c   [unknown]
CDS:CJA38885b CJA38885b   [unknown]
CDS:CJA38885a CJA38885a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-ncr-2, ACTCGTTTCTTCAGTTTATGCACCCACGCGGAACTTGTTGCAAGACAAACGGCAATAACT, WBGene00179841   Expr1083746 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA13941, CAAAAGCTGACAATTGCGATTTCTGCTGTGATTTTCAGCGTTATCAGTGTCTGGTGGTAA, WBGene00133145   Expr1077434 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region