WormMine: Gene WBGene00215300

• WormBase Gene ID: WBGene00215300
• Gene Name: CJA39453
• Sequence Name: CJA39453
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable metalloendopeptidase activity. Predicted to be involved in proteolysis. Predicted to be located in membrane. Is an ortholog of C. elegans Y56A3A.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA39453b.1	CJA39453b.1		[unknown]
Transcript:CJA39453a.1	CJA39453a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA39453a	CJA39453a		[unknown]
CDS:CJA39453b	CJA39453b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078939
• Remark: CJA11455, CACGTGGCAACAAAAGACGACTGGTGGAGGTGTATTCGGGAGGCGCGACAGATGCATAAT, WBGene00130659
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region