WormMine: Gene WBGene00215961

• WormBase Gene ID: WBGene00215961
• Gene Name: CJA40113
• Sequence Name: CJA40113
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water. Is an ortholog of C. elegans fat-5. In C. elegans, fat-5 is involved in long-chain fatty acid biosynthetic process and post-embryonic development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA40113.1	CJA40113.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA40113	CJA40113		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076273
• Remark: CJA26322, GGGGCTCGTGTATGATAGGAAAACGACGGCGGAAGAGGTGATTGAGAGGCAGTGCAAAAA, WBGene00181894
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region