WormMine: Gene WBGene00216168

• WormBase Gene ID: WBGene00216168
• Gene Name: CJA40320
• Sequence Name: CJA40320
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in ubiquitin-dependent protein catabolic process. Is an ortholog of C. elegans elc-1. In C. elegans, elc-1 is involved in anterior/posterior axis specification, embryo; positive regulation of metaphase/anaphase transition of meiotic cell cycle; and sister chromosome movement towards spindle pole involved in meiotic sister chromatid segregation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA40320.1	CJA40320.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA40320	CJA40320		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072070
• Remark: Cjp-elc-1, AAATTCCGTCGCACGTGCTTCAAAAGGTGTGCCAGTACTTTGCGTACAAGGTGCGCTACA, WBGene00132223
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region