WormMine: Gene WBGene00216328

• WormBase Gene ID: WBGene00216328
• Gene Name: CJA40480
• Sequence Name: CJA40480
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in RNA surveillance; nuclear-transcribed mRNA catabolic process, no-go decay; and nuclear-transcribed mRNA catabolic process, non-stop decay. Is an ortholog of C. elegans pelo-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA40480.1	CJA40480.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA40480	CJA40480		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089673
• Remark: CJA18206, GAACAATTGGCTCAATTGACTGGATGCGCTGCCATTCTCAGATTTCCTATGCCGGATTTG, WBGene00137409
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region