WormMine: Gene WBGene00217470

• WormBase Gene ID: WBGene00217470
• Gene Name: CJA41622
• Sequence Name: CJA41622
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in autophagosome assembly. Predicted to be part of Atg1/ULK1 kinase complex. Is an ortholog of C. elegans atg-13.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA41622a.1	CJA41622a.1		[unknown]
Transcript:CJA41622b.1	CJA41622b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA41622a	CJA41622a		[unknown]
CDS:CJA41622b	CJA41622b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090667
• Remark: CJA28192, GCGAATGACACCGATGCATCGGTTGTATGTGAAGAAGCAGAATTTGGAGTCGTTTATTAT, WBGene00183766
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region