WormMine: Gene WBGene00271441

• WormBase Gene ID: WBGene00271441
• Gene Name: CBG30875
• Sequence Name: CBG30875
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable L-ascorbic acid binding activity; iron ion binding activity; and oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen. Is an ortholog of C. elegans Y43F8B.19.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG30875.1	CBG30875.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG30875	CBG30875		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057800
• Remark: CBG05671, GCCGCAATACGACCAAACACAGGAGACGCATTTTTCTGGTTCAACGCGATGGGAAATACT, WBGene00028075
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region