WormMine: Gene WBGene00271676

• WormBase Gene ID: WBGene00271676
• Gene Name: CBG31011
• Sequence Name: CBG31011
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity and DNA topoisomerase type I (single strand cut, ATP-independent) activity. Predicted to be involved in DNA topological change. Is an ortholog of C. elegans Y48C3A.14.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG31011.1	CBG31011.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG31011	CBG31011		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059690
• Remark: CBG20786, GAGCAGAGTTGGAGGAGCAATTGAATTTAGTTGCTAGTGGGAAGGCGGATTATCATGATG, WBGene00039708
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region