WormMine: Gene WBGene00302967

• WormBase Gene ID: WBGene00302967
• Gene Name: CBG31147
• Sequence Name: CBG31147
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable nucleic acid binding activity. Predicted to be involved in tRNA 5'-leader removal. Predicted to be part of nucleolar ribonuclease P complex and ribonuclease MRP complex. Is an ortholog of C. elegans Y62E10A.24.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG31147.1	CBG31147.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG31147	CBG31147		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052934
• Remark: CBG01782, GGTGCATCTGTGAACAAAGCCTTGGTTTTTGCCATGGAAGTTGAAAGGAAGTTTGGAGGA, WBGene00024969
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region