WormMine: Gene WBGene00302975

• WormBase Gene ID: WBGene00302975
• Gene Name: CBG31152
• Sequence Name: CBG31152
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in GPI anchor biosynthetic process. Predicted to be located in endoplasmic reticulum membrane. Is an ortholog of C. elegans F49E8.8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG31152.1	CBG31152.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG31152	CBG31152		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055370
• Remark: CBG05911, GAACATCGGCTTGTTCAATTTGGCATGCACCATCAATTCCTCCGAAAACTTTCTGTGTAT, WBGene00028269
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region