WormMine: Gene WBGene00000090

• WormBase Gene ID: WBGene00000090
• Gene Name: age-1
• Sequence Name: B0334.8
• Brief Description: age-1 encodes the C. elegans ortholog of the phosphoinositide 3-kinase (PI3K) p110 catalytic subunit; AGE-1, supplied maternally and embryonically, is a central component of the C. elegans insulin-like signaling pathway, lying downstream of the DAF-2/insulin receptor and upstream of both the PDK-1 and AKT-1/AKT-2 kinases and the DAF-16 forkhead type transcription factor, whose negative regulation is the key output of the insulin signaling pathway; in accordance with its role in insulin signaling, AGE-1 activity is required for regulation of metabolism, life span, dauer formation, stress resistance, salt chemotaxis learning, fertility, and embryonic development; although the age-1 expression pattern has not yet been reported, ectopic expression studies indicate that pan-neuronal age-1 expression is sufficient to rescue life-span defects, while neuronal, intestinal, or muscle expression can partially rescue dauer formation, and neuronal or muscle expression can rescue metabolic defects.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable 1-phosphatidylinositol-3-kinase activity and 1-phosphatidylinositol-4-phosphate 3-kinase activity. Involved in several processes, including dauer entry; determination of adult lifespan; and regulation of synaptic assembly at neuromuscular junction. Located in cytoplasm and non-motile cilium. Part of phosphatidylinositol 3-kinase complex. Expressed in amphid neurons; anchor cell; hypodermis; and pharyngeal-intestinal valve. Human ortholog(s) of this gene implicated in several diseases, including breast cancer (multiple); gastrointestinal system cancer (multiple); and reproductive organ cancer (multiple). Is an ortholog of human PIK3CB (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta); PIK3CD (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta); and PIK3CG (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma).
• Biotype: SO:0001217
• Genetic Position: II :3.612 ±0.011314
• Length (nt): 7727

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000090

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:B0334.8a.1	B0334.8a.1	3929	II: 11519328-11527054
Transcript:B0334.8b.1	B0334.8b.1	231	II: 11519708-11520646

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:B0334.8a	B0334.8a	3549	II: 11519708-11519839
CDS:B0334.8b	B0334.8b	231	II: 11519708-11519839

34 RNAi Result

• WBRNAi00110200
• WBRNAi00000914
• WBRNAi00038934
• WBRNAi00093217
• WBRNAi00009702
• WBRNAi00009709
• WBRNAi00021223
• WBRNAi00109597
• WBRNAi00109209
• WBRNAi00093218
• WBRNAi00088015
• WBRNAi00088018
• WBRNAi00088017
• WBRNAi00090744
• WBRNAi00065300
• WBRNAi00112457
• WBRNAi00088016
• WBRNAi00092310
• WBRNAi00092312
• WBRNAi00092311
• WBRNAi00108165
• WBRNAi00109306
• WBRNAi00077741
• WBRNAi00077762
• WBRNAi00077764
• WBRNAi00101335
• WBRNAi00101334
• WBRNAi00101336
• WBRNAi00085027
• WBRNAi00109500

174 Allele

• gk963801
• gk963053
• gk962684
• gk963539
• gk963482
• WBVar01605093
• WBVar01605094
• WBVar01605095
• WBVar01605096
• WBVar01547105
• gk591589
• WBVar01784552
• gk456652
• gk936056
• gk931485
• gk393964
• gk471159
• WBVar01784553
• gk471158
• gk471157
• gk901086
• gk493090
• gk471156
• gk523913
• gk461301
• gk487451
• WBVar01559680
• gk782257
• gk617767
• gk813431

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000090
• Start: 11519328
• End: 11527054
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

149 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
Bacteria diet: Escherichia coli HB101. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
	Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage.	DEseq2, fold change > 2	WBPaper00064505:tamoxifen_upregulated
	Significantly differentially expressed genes as determined by microarray analysis of wild-type and cde-1 mutant germlines.	RNAs that changed at least 2-fold with a probability of p < 0.05 were considered differentially regulated between wildtype and cde-1.	WBPaper00035269:cde-1_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Genes down regulated by mir-243(n4759).	RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243.	WBPaper00036130:mir-243_down_regulated
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:germline-precursors_blastula-embryo_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed significantly decreased expression in the neurons of bcat-1(RNAi) animals at 5-days post L4 adult hermaphrodite stage, comparing to animals injected with empty vector.	DESeq2. FDR < 0.05.	WBPaper00060459:bcat-1(RNAi)_downregulated
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated

9 Expression Patterns

• Primary Identifier: Expr4268
• Subcellular Localization: AGE-1::GFP was observed throughout the cell.

• Primary Identifier: Expr5053
• Remark: Also expressed in (comments from author) : No comments. Strain: BC10837
• Reporter Gene: [age-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGGATCAGACCATCAGGAAGA] 3' and primer B 5' [GATACGTCGGGAGTTCCGT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; amphids; Larval Expression: intestine; Nervous System; head neurons; amphids

• Primary Identifier: Expr2009259
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1030042
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr10150
• Pattern: Strong age-1 EGFP fluorescence was observed in two pairs of amphidial neurons and their dendritic processes, a pair of inter-neurons or support cells anterior to the nerve ring, and the sphincter connecting the pharynx to the intestine. Variable expression was also noted in the hypodermis and the intestine between lines, with some lines having moderate expression in these tissues and others having little or no expression. Weak expression in a phasmidial neuron was observed in a minority of worms in each line. Examination of transgenic C. elegans L1 and adult hermaphrodites revealed expression of Ce-age-1 in the AWC and ASJ amphidial neuron pairs.

• Primary Identifier: Expr1021630
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr16210
• Pattern: In untreated or empty vector-treated control RNAi animals, GFP::AGE-1 and AAP-1::GFP were both expressed in the AC and the surrounding cells at the Pn.pxx stage before and during invasion. Interestingly, the GFP:: AGE-1 and AAP-1::GFP proteins were asymmetrically localized in the AC and appeared polarized toward the invasive membrane.

• Primary Identifier: Expr2027496
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1143118
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

39 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000090
• Start: 11519328
• End: 11527054
• Strand: -1

39 Ontology Annotations

7 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes upregulated by > 2-fold in CY262(sqt-1(sc13) age-1(mg44); bvIs1) adults, which intestinally express age-1, relative to wildtype.	> 2-fold-change, p-value <= 0.05, t-test.	WBPaper00038237:age-1_upregulated_intestine_rescue
	Genes upregulated by > 2-fold in CY251(sqt-1(sc13) age-1(mg44); bvIs2) adults, which neuronally express age-1, relative to wildtype.	> 2-fold-change, p-value <= 0.05, t-test.	WBPaper00038237:age-1_upregulated_neuron_rescue
	Genes upregulated by > 2-fold in SP75 (sqt-1(sc13) age-1(mg44)/mnC1) adults relative to wildtype.	> 2-fold-change, p-value <= 0.05, t-test.	WBPaper00038237:age-1_upregulated_nontransgenic
	Genes that showed decreased expression in age-1 (mg44, m333) comparing to N2DRM. 253 (92%) at FDR <3%, 341 (89%) at FDR <5.5%, with expression in age-1(mg44, m333) < N2DRM	SAM	WBPaper00035211:age-1_vs_N2_downregulated
	Genes that showed increased expression in age-1 (mg44, m333) comparing to age-1(hx546). 206 (61%) at FDR <5%, with expression in age-1(mg44, m333) < age-1(hx546).	SAM	WBPaper00035211:age-1_vs_age-1_downregulated
	Genes that showed increased expression in age-1 (mg44, m333) comparing to age-1(hx546). 133 (39%) at FDR <5%, with expression in age-1(mg44, m333) > age-1(hx546).	SAM	WBPaper00035211:age-1_vs_age-1_upregulated
	Genes that showed increased expression in age-1 (mg44, m333) comparing to N2DRM. 23 (8.3%) at FDR <3%, 44 (11%) at FDR <5.5%, with expression in age-1(mg44, m333) > N2DRM.	SAM	WBPaper00035211:age-1_vs_N2_upregulated

1 Sequence

• Length: 7727

1 Sequence Ontology Term