WormMine: Gene WBGene00001377

• WormBase Gene ID: WBGene00001377
• Gene Name: eya-1
• Sequence Name: C49A1.4
• Brief Description: eya-1 encodes a protein orthologous to the Eyes absent/Eya Drosophila protein which is involved in eye development and has protein tyrosine phosphatase ; RNA interference and mutant studies indicate that eya-1 is involved in embryonic and larval tissue morphogenesis as well as larval viability; eya-1 mutants show increased embryonic cell deaths due to activation of the cell death pathway; eya-1 functions redundantly with vab-3/eyeless to control larval viability and anterior body morphogenesis; GFP studies show that eya-1 is expressed in a subset of nuclei during embryonic morphogenesis; the human genes EYA1 and EYA4, when mutated, lead to disease syndromes.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable protein tyrosine phosphatase activity and transcription coactivator activity. Involved in several processes, including egg-laying behavior; positive regulation of cellular response to heat; and regulation of apoptotic process. Located in nucleus. Expressed in several structures, including body wall musculature; intestine; and pharynx. Human ortholog(s) of this gene implicated in several diseases, including auditory system disease (multiple); branchiootorenal syndrome 1; and dilated cardiomyopathy 1J. Is an ortholog of several human genes including EYA1 (EYA transcriptional coactivator and phosphatase 1); EYA2 (EYA transcriptional coactivator and phosphatase 2); and EYA4 (EYA transcriptional coactivator and phosphatase 4).
• Biotype: SO:0001217
• Genetic Position: I :23.8881 ±0.07657
• Length (nt): 10668

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001377

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C49A1.4a.1	C49A1.4a.1	1810	I: 14220693-14231360
Transcript:C49A1.4b.1	C49A1.4b.1	1703	I: 14220706-14231030
Transcript:C49A1.4b.3	C49A1.4b.3	1475	I: 14220816-14227104
Transcript:C49A1.4b.2	C49A1.4b.2	1496	I: 14220873-14227224

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C49A1.4a	C49A1.4a	1512	I: 14220873-14220959
CDS:C49A1.4b	C49A1.4b	1410	I: 14220873-14220959

7 RNAi Result

• WBRNAi00063937
• WBRNAi00042756
• WBRNAi00063938
• WBRNAi00029954
• WBRNAi00063935
• WBRNAi00063936
• WBRNAi00063939

203 Allele

• gk963849
• gk964175
• gk962681
• h4628
• h3977
• gk963947
• gk962708
• ok654
• WBVar00243720
• WBVar01915278
• gk661719
• WBVar01557469
• gk128729
• gk128730
• gk128731
• gk128732
• gk128727
• gk128728
• gk128733
• gk128734
• gk128735
• gk128736
• gk128737
• gk128738
• gk128739
• gk128715
• gk128716
• gk128718
• gk128719
• gk128720

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001377
• Start: 14220693
• End: 14231360
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_14220625..14220692
• Length (nt): 68
• Chromosome Location: I: 14220625-14220692
• Organism: Caenorhabditis elegans

188 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva.	Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage.	DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3.	WBPaper00058958:100mGy-irradiation-72h_upregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
Starvation	Transcripts that showed significantly altered expression by starvation with 100 mM salt (NaCl)	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:starvation_regulated_LowSalt
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to tiling array analysis towards total RNA.	A linear model and moderated t-statistic were used to determine differentially expressed genes as implemented by the limma package (v3.21.4). Enriched list contains only genes significantly enriched in the NSM neurons versus the reference <=1.5X and <= 5% FDR.	WBPaper00045974:NSM_enriched_totalRNA_tiling
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly increased expression in animals fed with JM103 bacteria producing Cry5B, comparing to control animals fed with JM103.	ANOVA, p-value < 0.05.	WBPaper00056167:Cry5B_upregulated
	Strictly embryonic class (SE): genes that are the subset of embryonic genes that are not also classified as maternal.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SE

9 Expression Patterns

• Primary Identifier: Expr1030829
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr5536
• Remark: Strain: BC14151
• Reporter Gene: [eya-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGGTGCAAGTGGCTCA] 3' and primer B 5' [ATTCTGAAGATCAAATTTAAGGCG] 3'.
• Pattern: Adult Expression: intestine - posterior cells; Larval Expression: intestine - posterior cells

• Primary Identifier: Expr3777
• Pattern: EYA-1::GFP expression was first detected in the nuclei of several anterior cells at the bean stage when embryo starts morphogenesis. As embryogenesis progressed, the number of EYA-1 expressing cells in the anterior region and the intensity of the signal increased. From 1.5-fold to pretzel stage when embryos elongate and pharyngeal structure is organized, expression of EYA-1::GFP was prominent in the nuclei of a subset of pharyngeal cells as well as several anterior body wall muscle cells. The EYA-1::GFP expression continued until hatch. --precise ends.
• Subcellular Localization: Expressed in nuclei.

• Primary Identifier: Expr14291
• Pattern: An EYA-1::GFP reporter was expressed in BAG neurons as well as many non-BAG cells.

• Primary Identifier: Expr16094
• Pattern: We first examined eya-1 expression in pharyngeal neurons using a genomic fragment that contains the entire, gfp-tagged eya-1 locus (Furuya et al., 2005). We observed expression in all pharyngeal neurons throughout all larval and adult stages, a phenocopy of the ceh-34 expression pattern, that is also corroborated by our recent scRNA analysis (Taylor et al., 2021).

• Primary Identifier: Expr2011410
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1146744
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2029646
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1027245
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

52 GO Annotation

15 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001377
• Start: 14220693
• End: 14231360
• Strand: -1

52 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 10668

1 Sequence Ontology Term