WormMine: Gene WBGene00002881

• WormBase Gene ID: WBGene00002881
• Gene Name: let-756
• Sequence Name: C05D11.4
• Brief Description: let-756 encodes an fibroblast growth factor (FGF)-like ligand that is required for progression through early larval development; LET-756 is expressed from late embryogenesis to adulthood, with a peak of expression in larvae; with EGL-17, LET-756 is redundantly required to activate EGL-15/FGFR, which in turn activates protein degradation in adult muscle cells; homozygotes for partial loss-of-function alleles are small, clear, and scrawny, but viable, while those for a null allele arrest in early larval development.
• Organism: Caenorhabditis elegans
• Automated Description: Enables RNA polymerase II-specific DNA-binding transcription factor binding activity; growth factor activity; and protein kinase binding activity. Involved in fibroblast growth factor receptor signaling pathway; nematode larval development; and regulation of cellular component organization. Located in cytoplasm; extracellular space; and nuclear lumen. Expressed in several structures, including CAN; OLL; cephalic sensillum; muscle cell; and pharyngeal cell. Human ortholog(s) of this gene implicated in several diseases, including Alzheimer's disease; brain disease (multiple); carcinoma (multiple); and eye disease (multiple). Is an ortholog of human FGF3 (fibroblast growth factor 3).
• Biotype: SO:0001217
• Genetic Position: III :-1.28614 ±0.006892
• Length (nt): 2905

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00002881

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C05D11.4.1	C05D11.4.1	1727	III: 6407129-6410033

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C05D11.4	C05D11.4	1278	III: 6407137-6407226

10 RNAi Result

• WBRNAi00068091
• WBRNAi00039736
• WBRNAi00039737
• WBRNAi00010197
• WBRNAi00010198
• WBRNAi00005843
• WBRNAi00030220
• WBRNAi00116212
• WBRNAi00116194
• WBRNAi00090613

35 Allele

• gk964518
• gk176544
• gk176545
• gk176546
• s2613
• s2809
• s2887
• WBVar01264372
• h7966
• tm5545
• WBVar01837672
• gk403476
• gk320353
• WBVar01645071
• gk433746
• gk904474
• gk339274
• gk375365
• gk414197
• gk393670
• gk374126
• gk790725
• gk435973
• gk568301
• gk867971
• gk570367
• WBVar01893518
• gk443312
• gk962404
• gk883828

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00002881
• Start: 6407129
• End: 6410033
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

132 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
Reduced humidity (98% relative humidity).	Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis.	Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001.	WBPaper00044578:reduced-humidity_downregulated_microarray
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:mep-1(ne4629)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in npr-15(tm12539) comparing to in N2 at L4 larva stage.	Fold change > 2, FDR < 0.05.	WBPaper00066608:npr-15(tm12539)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:eat-2(ad1116)_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point on the non pathogenic strain Bt407 compared to E. coli OP50.	Cuffdiff	WBPaper00060358:B.thuringiensis_non-pathogen_regulated_elt-2(RNAi)
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult

16 Expression Patterns

• Primary Identifier: Expr4753
• Remark: Type: mammalian cell transfection. EGFP-tagged constructs were used.
• Subcellular Localization: In the nucleus, LET-756 was found as bright punctuate structures that colocalized with U1 SnRNP70, only partially with non-SnRNP splicing factor SC35, and not with Cajal body SMN protein bodies or promyelocytic leukemia (PML) oncoprotein bodies. No, or faint EGFP expression was colocalized with nucleolar markers fibrillarin or nucleolin.

• Primary Identifier: Expr4754
• Subcellular Localization: By using a polyclonal anti-LET-756 antibody, the same expression pattern was obtained with untagged LET-756 proteins (wild-type or R318Stop mutant), and with or without actinomycin. See Expr4752 and Expr4753.

• Primary Identifier: Expr4752
• Pattern: Previously study has shown that LET-756 is expressed in the nuclei and the cytoplasm of muscle cells and neurons of wild-type animals transformed with a cDNA- or genomic-GFP construct(see Expr3197).
• Subcellular Localization: In the nucleus, most often only the nucleoplasm and not the nucleolus was stained.

• Primary Identifier: Expr5171
• Remark: Strain: BC10312
• Reporter Gene: [let-756::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACCCATTCCTTCTCGGTTT] 3' and primer B 5' [CAGGAACGGCGATATATTCA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; body wall muscle; Nervous System; head neurons; unidentified cells in body ; Larval Expression: pharynx; body wall muscle; Nervous System; head neurons; unidentified cells in body

• Primary Identifier: Expr5172
• Remark: Also expressed in (comments from author) : unidentified cells in head, possibly neuralEmbryo incomplete. To be updated. Strain: BC12925
• Reporter Gene: [let-756::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACCCATTCCTTCTCGGTTT] 3' and primer B 5' [CAGGAACGGCGATATATTCA] 3'.
• Pattern: Adult Expression: pharynx; body wall muscle; Nervous System; neurons along body; unidentified cells in head; Larval Expression: pharynx; body wall muscle; Nervous System; neurons along body; unidentified cells in head

• Primary Identifier: Expr1031369
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr12259
• Pattern: let-756 expression is observed in pharyngeal and body muscle cells as well as in some neurons (CAN or cephalic).
• Subcellular Localization: LET-756 shares features with FGFs of different families, such as expression in cytoplasm and nucleus of muscles and neurons.

• Primary Identifier: Expr3197
• Pattern: GFP expression in the cells and nuclei of body-wall muscle cells.

• Primary Identifier: Expr11992

• Primary Identifier: Chronogram183
• Remark: Original chronogram file: chronogram.1213.xml
• Reporter Gene: [C05D11.4:gfp] transcriptional fusion.

• Primary Identifier: Expr2013075
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1143828
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1027267
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram3
• Remark: Original chronogram file: chronogram.100.xml
• Reporter Gene: [C05D11.4:gfp] transcriptional fusion.

• Primary Identifier: Expr2031307
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1236
• Pattern: A single 1.7 kb transcript was detected. Barely visible at embryo, peaked at L2 and L3 larva.

44 GO Annotation

9 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00002881
• Start: 6407129
• End: 6410033
• Strand: 1

44 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2905

1 Sequence Ontology Term