Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:ZC247.3.1 | ZC247.3.1 |
1526
 |
I: 10248288-10255327 |
Other
1 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:ZC247.3 | ZC247.3 |
1218
|
I: 10248339-10248571 |
101 Allele
| Public Name |
|---|
| gk962858 |
| gk962706 |
| gk963902 |
| gk963849 |
| h14328 |
| h7739 |
| ps1 |
| sy251 |
| WBVar01432709 |
| WBVar01432711 |
| WBVar01432713 |
| WBVar01432714 |
| WBVar01432710 |
| n566 |
| WBVar01910269 |
| WBVar01662741 |
| WBVar01662740 |
| tm5323 |
| WBVar00100369 |
| WBVar00100368 |
| WBVar01957644 |
| WBVar00156445 |
| WBVar00156446 |
| WBVar00214049 |
| WBVar01411694 |
| WBVar01347936 |
| n672 |
| gk962091 |
| tm5991 |
| gk422080 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00003000 | 10248288 | 10255327 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrI_10255328..10255545 | 218 | I: 10255328-10255545 | Caenorhabditis elegans |
193 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. | DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. | WBPaper00060811:L1_vs_adult_upregulated_neural | |
| Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:A-class-motor-neurons_larva_enriched | |
| Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:all-neurons_L1-larva_expressed | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| Transcripts enriched in ASG according to single cell RNAseq. | Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched. | WBPaper00061651:ASG_enriched | |
| Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:AVE-neuron_L1-larva_expressed | |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. | DESEQ2, fold change > 2 and FDR < 0.01. | WBPaper00062103:neuron_enriched | |
| Single-cell RNA-Seq cell group 71_0 expressed in neuron. | scVI 0.6.0 | WBPaper00065841:71_0 | |
| Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. | Fold change > 2, FDR < 0.01. | WBPaper00065993:glp-1(e2141)_upregulated | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141) | |
| Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141) | |
| Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage. | DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01. | WBPaper00056169:rrf-3(pk1426)_upregulated_embryo | |
| Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. | Fold change > 2. | WBPaper00064306:Agaro-oligosaccharides_upregulated | |
| Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
| Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
| Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. | DESeq2 version 1.22.2, p < 0.05 | WBPaper00064716:paraquat_downregulated | |
| Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. | DESeq | WBPaper00053302:stavudine_24h_regulated | |
| Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. | DESeq2, fold change > 2, adjusted p-value < 0.01 | WBPaper00058598:sin-3(tm1276)_downregulated | |
| Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. | DESeq2, FDR < 0.05, fold change > 2. | WBPaper00065975:P-body_vs_WholeAnimal_depleted | |
| Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:A-class-motor-neurons_L2-larva_expressed | |
| Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:all-neurons_L2-larva_expressed | |
| Transcripts that showed significantly increased expression in animals with germline-specific inx-14(RNAi) comparing to in aniamls fed with control vector, both exposed to PA14 infection. | DESeq2. Differentially-expressed genes (DEG) were identified based on two criteria: FDR (False discovery rateusing Benjamini-Hochberg adjusted p-values) < 0.01 and absolute value of log2(Fold Change) > 1. | WBPaper00066146:germline-inx-14(RNAi)_upregulated_PA14 | |
| Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. | Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. | WBPaper00053810:daf-2(e1370)_upregulated | |
| Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:coelomocytes_L2-larva_expressed | |
| Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. | Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. | WBPaper00061479:hda-1(ne4752)_upregulated |
41 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Reporter gene fusion type not specified. | Expr4650 | The Plin-11 gfp reporter is expressed in the six VC motor neurons, P3 - 8.aap , of the ventral cord. | ||
| Expr1031397 | Tiling arrays expression graphs | |||
| Picture: N.A. | Marker17 | Expressed in secondary fate VPC. | ||
| Picture: N.A. | Marker77 | Marker for secondary fate VPC. | ||
| Expr1162243 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Strain: BC14491 | [lin-11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATCTGTGTCGGTTTCTCACAT] 3' and primer B 5' [GAAGAATGGATTGAGAAGGGAGTA] 3'. | Expr7155 | Adult Expression: intestine; vulval muscle; body wall muscle; Nervous System; neurons along body; Larval Expression: intestine; developing vulva; body wall muscle; Nervous System; neurons along body; | |
| Feature : lin-11 enhancer region, mpB. Reporter gene fusion not specified. | Expr11407 | The mpB is located within a 2.0 kb region that is necessary for the expression of Cel-lin-11 in embryonic neurons. | ||
| Expr14671 | The lin-11-int3p::GFP (pGLC59) transgenic lines that contain the entire intron 3 sequence showed GFP reporter expression in seven neurons at the larval stage L4. These include two sensory neurons (ADL and ADF), four interneurons (AVJ, RIC, AIZ, and RIF) and one pioneer interneuron (AVG). Expression was also detected in embryos. Because some of the lin-11 neurons are specified in the embryo, lin-11::GFP was expected to be expressed in these neurons during their specification. Consistent with this, GFP fluorescence was observed as early as in the pre-gastrula stage in the presumptive head and tail regions. By the 3-fold embryonic stage, fluorescence could be seen in neuronal cells in the anterior region. GFP fluorescence in ADL, ADF and AVJ was very strong and observed in almost all animals. Fluorescence was less frequently observed in RIC and AIZ and was rarely seen in RIF and AVG. | |||
| Expr14672 | Intron 7-driven GFP reporter fluorescence was first detected in two head neurons in post-gastrulating embryos; based on reporter gene expression, one of those neurons is likely to be AVG. The identification of this neuron as AVG in larval stages was confirmed by co-localization with two reporters, glr-1::DsRed and odr-2::DsRed (Chou et al., 2001; Maricq et al., 1995). The other unidentified cell had variable fluorescence. Fluorescence in lin-11-int-7p::GFP animals persisted in both neurons throughout the larval stages, but the intensity decreased with time. Adults showed faint expression mostly in AVG. | |||
| Clone: pUL#JRH10E7 | Expr7750 | Expression observed from mid embryo to adult. Dorsal nerve cord, subset of ventral nerve cord, two head nerves lateral to posterior pharyngeal bulb, two nerves in tail. Also in developing vulva in L3/4. Variable expression in intestine, head muscles, body muscles and pharynx all possibly artifactual. | ||
| Expr2830 | Expression of lin-11::GFP is first observed after the time when most postmitotic neurons are born (at approx. 300 minutes postfertilization). In larvae, the LIN-11::GFP fusion protein is localized to the nuclei of multiple neurons in the head and lumbar ganglia. In addition, lin-11 expression is observed in uterine and vulval cells, as well as in the VC motor neurons. In the lumbar ganglia, lin-11 expression is observed in the PVPL/R and PVQ neurons, and in an additional unpaired neuron identified as DVC or DVA. In contrast to shorter lin-11::GFP fusion genes, the rescuing lin-11::GFP fusion gene is not expressed in the PHA sensory neurons. In the head, lin-11 expression was observed in the sensory neurons ADF and ADL, in the interneurons AIZ, RIC and AVG, and in another neuron type tentatively identified as either AVH or AVJ. However, expression in a number of additional neurons was also observed using the full-length lin-11::GFP fusion gene. lin-11 expression was observed in the AVA and AVE interneurons. Faint and occasional expression was also detected in the ASH polymodal sensory neurons. lin-11 expression was observed in the AWA neurons in embryos and young larvae, but not in later stages. Expression of lin-11 in the AWA neurons is observed consistently in three-fold embryos, where expression of lin-11 overlaps with that of ODR-7 (32/32 AWA neurons examined). Expression decreases by hatching such that in L1 larvae, expression in the AWA neurons is fainter and observed only occasionally, and is absent in later larvae and adults. lin-11 expression was also observed strongly and consistently in the ASG chemosensory neurons. Expression in the ASG neurons is observed throughout postembryonic development. lin-11 expression was also detected in a few other non-sensory neurons in the head and tail that were not identified definitively. | Expressed in nuclei of multiple neurons in the head and lumbar ganglia. | ||
| Expr15627 | ||||
| Expr15382 | ||||
| intron 3 | Expr15383 | |||
| intron 7 | Expr15384 | |||
| Expr14674 | The intron 7 was dissected into two overlapping fragments, each driving a GFP reporter (pGLC65 and pGLC66). pGLC65 carries both conserved regions, i.e., C7-1 and C7-2. Examination of pGLC65 transgenic animals revealed GFP fluorescence in two neurons, namely AVG and RIF. The fluorescence in AVG was comparatively brighter and seen in many animals (55%, n=65), but RIF fluorescence was observed at a much lower frequency (34%, n=65). Another unidentified neuron was also faintly visible in a few animals. | |||
| Data modified according to Shawn Lockery's expression pattern curations. | Expr261 | ADL ADF AVH (or AVJ) AVG AIZ RIC VC PHA PVQ [O. Hobert(personal communication to Shawn Lockery). lin-11-GFP expression can be observed from late embryonic stages throughout larval and adult stages. The lin-11-GFP-expressing cells were identified in early larval stages. At the L1 stage, lin-11-GFP expression is exclusively confined to neurons in the head ganglia and the lumbar ganglion in the tail. The neurons that express lin-11-GFP in the head ganglion are the sensory neurons ADF and ADL and the interneurons AIZ and RIC. Weak lin-11-GFP expression can be observed in the interneuron AVG that sends a process along the ventral cord. The identity of another head neuron pair that exhibits lin-11-GFP expression could not be unambiguously determined, but because of its characteristic axonal morphology in the ventral cord, authors tentatively assigned this pair of neurons as either the AVH or AVJ interneuron. | ||
| Expr14673 | To determine whether C3-1 possesses enhancer activity in any of these neurons, transgenic animals were generated carrying a GFP reporter under the control of a 382 bp fragment of intron 3. GFP expression in transgenic animals was observed in a single neuron pair, the RIC neurons. A similar expression pattern was also observed when the reporter was introduced into C. briggsae. | |||
| Expr12725 | ||||
| Marker103 | Marker for AIZ neurons. | |||
| Picture: Figure 2b. Reporter gene fusion type not specified. | Marker3 | The lin-11::GFP is expressed in the AIZ interneurons as well as several other head neurons. | ||
| Expr10496 | Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
| No detailed description on expression pattern in other life stage or anatomy parts. Reporter gene fusion type not specified. | Expr2574 | The developmental profile of the lin-11::GFP vulval expression in all three lines is nearly identical, although their fluorescence brightness can be ranked nIs96>syIs80>syIs53. The syIs80 and syIs53 animals reveal dynamic changes in the vulval GFP expression. The earliest GFP expression in syIs80 vulval cells is detected in one of the two daughters of the 2 lineage precursors (P5.pp and P7.pa cells). In most cases, GFP fluorescence was detectable only ~1-2 hours before the VPC daughters were beginning to divide. At this stage, expression in P6.p daughters is much weaker and rarely observed. During the Pn.pxx stage, vulval cells begin to reveal brighter GFP fluorescence in both the 1 and 2 lineages. In the 2 lineage, expression is typically seen in only the N and T cells. By the Pn.pxxx stage, lin-11::GFP expression is detected in all 2 lineage progeny. In general, vulA has the lowest level of expression compared with others. syIs53 animals reveal a similar pattern of expression, although the overall fluorescence is considerably reduced. By mid-L4 stage, the GFP fluorescence in syIs53 and syIs80 strains begins to fade, and can not be seen by late-L4 stage. However, in nIs96 animals fluorescence can be detected in young adult animals. Expression is also detected in the uterine lineage cells, VC neurons and a subset of the head and tail neurons. In addition, expression in the B.pap and its descendents was observed in the developing male proctodeum. | ||
| Feature : lin-11 enhancer region, mpA-2. Reporter gene fusion not specified. Authors used the deletion approach and examined the in vivo contribution of conserved sequences by introducing a series of smaller constructs in C. elegans. | Expr11406 | The mpA-2 region -47 bp- is likely to be involved in activating VCN-specific expression of lin-11. | ||
| Expr11432 | The lin-11 gene is specifically expressed in ventral cord motor neurons and thus the Plin-11::gfp reporter specifically labels the ventral cord cells, P3.aap-P8.aap. | |||
| Feature : lin-11 enhancer | Expr11398 | Examination of GFP fluorescence in transgenic animals revealed that the mpA-3 region is capable of activating lin-11p::GFP expression in uterine pi lineage cells. | ||
| Expr2013157 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr12787 | ||||
| Feature : lin-11 enhancer region, mpA-1. Reporter gene fusion not specified. Authors used the deletion approach and examined the in vivo contribution of conserved sequences by introducing a series of smaller constructs in C. elegans. | Expr11405 | a 52 bp enhancer region (mpA-1) is necessary for activating lin-11 expression in the vulva. | ||
| Expr3450 | The expression pattern of the LIN-11::GFP translational fusion construct (plin-11-ABCDE::GFP, which does not include the LIN-11 homeobox domain) was examined. This construct is expressed in wild-type animals both in the nucleus and in the cytoplasm of the {pi} cells and vulval cells. | Expressed in nucleus and cytoplasm. |
21 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in |
10 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |