WormMine: Gene WBGene00003822

• WormBase Gene ID: WBGene00003822
• Gene Name: nsy-1
• Sequence Name: F59A6.1
• Brief Description: nsy-1 encodes a MAP kinase kinase kinase (MAP3K) that is orthologous to the mammalian apoptosis signal-regulating kinase (ASK) family of protein kinases; nsy-1 activity is required for chemotaxis, egg laying, pathogen response, and response to anoxia; NSY-1 activity is activated by the calmodulin kinase UNC-43, and is required for lateral signalling that leads to asymmetric olfactory neuron fates; NSY-1 interacts with SEK-1, and is expressed in the intestine, hypodermis, rectal gland cells, and neurons.
• Organism: Caenorhabditis elegans
• Automated Description: Enables MAP kinase kinase kinase activity; mitogen-activated protein kinase kinase binding activity; and protein serine/threonine/tyrosine kinase activity. Involved in several processes, including determination of adult lifespan; positive regulation of macromolecule biosynthetic process; and response to stress. Located in axon cytoplasm; neuronal cell body; and postsynaptic density. Expressed in head; rectal gland cell; and tail. Used to study amphetamine abuse. Human ortholog(s) of this gene implicated in Huntington's disease and perinatal necrotizing enterocolitis. Is an ortholog of human MAP3K5 (mitogen-activated protein kinase kinase kinase 5).
• Biotype: SO:0001217
• Genetic Position: II :-2.59263 ±0.001611
• Length (nt): 7243

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003822

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F59A6.1a.1	F59A6.1a.1	5061	II: 5022757-5029999
Transcript:F59A6.1b.1	F59A6.1b.1	4832	II: 5022956-5029978

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F59A6.1b	F59A6.1b	4446	II: 5022956-5022967
CDS:F59A6.1a	F59A6.1a	4497	II: 5022914-5022967

25 RNAi Result

• WBRNAi00113207
• WBRNAi00046221
• WBRNAi00049111
• WBRNAi00022388
• WBRNAi00113160
• WBRNAi00086736
• WBRNAi00086738
• WBRNAi00112977
• WBRNAi00110864
• WBRNAi00113107
• WBRNAi00088703
• WBRNAi00108306
• WBRNAi00075832
• WBRNAi00098019
• WBRNAi00097052
• WBRNAi00077206
• WBRNAi00088596
• WBRNAi00077212
• WBRNAi00078849
• WBRNAi00113962
• WBRNAi00077214
• WBRNAi00097059
• WBRNAi00095257
• WBRNAi00094589
• WBRNAi00094596

121 Allele

• gk963801
• gk963053
• h7758
• h4207
• qd6
• tm829
• tm850
• WBVar01372366
• qd25
• qd29
• qd8
• qd23
• qd31
• qd1
• qd3
• qd55
• qd50
• qd52
• qd41
• qd44
• qd38
• WBVar02029212
• gk336951
• gk780772
• gk763719
• gk712147
• gk845372
• gk369752
• gk787144
• gk439518

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003822
• Start: 5022757
• End: 5029999
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

113 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
Growth temperature	Transcripts that are significantly downregulated at 15C compared to both 25C and 20C, with no statistical difference between 25C and 20C, in worms feeding B. subtilis PY79.	DESeq2 and EdgeR, adjusted p-value < 0.05.	WBPaper00053814:15C_downregulated_PY79
Bacteria infection: Staphylococcus aureus	mRNAs that showed increased expression 8 hours after N2 animals were infected by S. aureus.	DESeq, p <= 0.05	WBPaper00045314:S.aureus-induced_N2
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
Starvation 48 hours at L1 arrest	Transcripts that showed significantly increased expression in starved N2 animals (48 hours at L1 arrest)	Fold change > 2.	WBPaper00064005:starvation_upregulated_N2_mRNA
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in sma-2(rax5) comparing to in N2 at 1-day post-L4 adult hermaphrodite	HTseq-count was used to count reads mapped to each gene and counting data was imported to EdgeR for statistical analysis. Statistical significance was defined by adjusted P value (false discovery rate, FDR) of <0.05.	WBPaper00053184:sma-2(rax5)_upregulated
	Transcripts that showed significantly increased expression in sma-4(rax3) comparing to in N2 at 1-day post-L4 adult hermaphrodite	HTseq-count was used to count reads mapped to each gene and counting data was imported to EdgeR for statistical analysis. Statistical significance was defined by adjusted P value (false discovery rate, FDR) of <0.05.	WBPaper00053184:sma-4(rax3)_upregulated
	Genes that showed decreased expression after 1-methylnicotinamide (MNA) treatment.	Raw counts for the genes were analyzed using the R Statistical Computing Environment and the Bioconductor packages DESeq and edgeR. Both packages provide statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochberg's approach for controlling the false discovery rate (FDR). If both FDR values (by DESeq and edgeR) were smaller than p = 0.05, genes were assigned as differentially expressed.	WBPaper00044260:1-methylnicotinamide_downregulated

11 Expression Patterns

• Primary Identifier: Expr1031799
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6260
• Remark: Also expressed in (comments from author) : Notes were not entered into database, and images are only for adult. Have extrapolated data from the images, but this leaves the analysis incomplete. Unidentified head/tail GFP may be neural. Strain: BC10545
• Reporter Gene: [nsy-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCCTCACCGACAGTTTAAG] 3' and primer B 5' [CTGCGAGATTTTCTTTTGATTCTT] 3'.
• Pattern: Adult Expression: intestine; hypodermis; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr894
• Remark: A shorter transcriptional GFP fusion gene with 5 kb of upstream sequence, and a translation fusion of GFP to the entire NSY-1 protein with 3.8 kb of upstream sequence, were expressed in many cells but not in the AWC neurons.
• Pattern: Expressed in the intestine, hypodermis, rectal gland cells, and neurons, including both AWC neurons.

• Primary Identifier: Expr9641
• Pattern: NSY-1 expression was notably enriched in the TIR-1-containing puncta in the AWC axon.

• Primary Identifier: Expr1152852
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram708
• Remark: Original chronogram file: chronogram.1739.xml
• Reporter Gene: [F59A6.1:gfp] transcriptional fusion.

• Primary Identifier: Chronogram667
• Remark: Original chronogram file: chronogram.1696.xml
• Reporter Gene: [F59A6.1:gfp] transcriptional fusion.

• Primary Identifier: Expr2032745
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2014506
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr13446
• Subcellular Localization: GFP::NSY-1 localized to presynaptic boutons of PLM neurons. Also localized to axon and synaptic branch (fig8B)

• Primary Identifier: Expr1026493
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

45 GO Annotation

11 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003822
• Start: 5022757
• End: 5029999
• Strand: 1

45 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 7243

1 Sequence Ontology Term