WormMine: Gene WBGene00005071

• WormBase Gene ID: WBGene00005071
• Gene Name: srb-6
• Sequence Name: R05H5.6
• Brief Description: srb-6 encodes a seven-transmembrane protein predicted to function as a chemosensory receptor; an srb-6 reporter fusion is expressed in multiple chemosensory neurons, including ASH, ADL, PHA, and PHB, and also in the vulval region.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable transmembrane signaling receptor activity. Involved in defense response to Gram-positive bacterium and detection of chemical stimulus. Located in cilium. Expressed in chemosensory neurons; head; tail; and uv1.
• Biotype: SO:0001217
• Genetic Position: II :2.24133 ±0.006426
• Length (nt): 1931

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00005071

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:R05H5.6.1	R05H5.6.1	1014	II: 10194905-10196835

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:R05H5.6	R05H5.6	1014	II: 10194905-10194922

3 RNAi Result

• WBRNAi00051348
• WBRNAi00034642
• WBRNAi00017480

32 Allele

• gk963801
• gk963053
• gk962682
• WBVar01604572
• WBVar01604573
• h9092
• gk152392
• gk152391
• gk152393
• gk152388
• gk152390
• gk152389
• gk942128
• WBVar01720537
• WBVar01720539
• WBVar01720538
• gk552676
• ttTi37032
• gk921280
• gk344017
• gk665492
• gk340444
• gk925263
• gk891014
• gk393624
• WBVar01310777
• WBVar01413857
• WBVar00174965
• WBVar00174964
• WBVar02040492

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00005071
• Start: 10194905
• End: 10196835
• Strand: 1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_10196836..10197624
• Length (nt): 789
• Chromosome Location: II: 10196836-10197624
• Organism: Caenorhabditis elegans

16 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
Bacteria infection: Serratia marcescens	Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:S.marcescens_24hr_upregulated_TilingArray
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
Bacteria infection: Serratia marcescens	Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:S.marcescens_24hr_upregulated_RNAseq
Bacteria infection: Photorhabdus luminescens	Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:P.lumniescens_24hr_upregulated_TilingArray
25C vs. 20C	Transcripts that showed significantly decreased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_downregulated
	Genes identified as up-regulated at a 5% false discovery rate through RNAseq experiments with three tatn-1(qd182) and three N2 RNA samples.	ANOVA with FDR <= 0.05.	WBPaper00044656:tatn-1(qd182)_upregulated
Fungi infection: Fusarium oxysporum	Transcripts that showed significantly altered expression after infected by fungi Fusarium oxysporum from 0 t0 48 hours.	The Benjamini and Hochberg approach was used to adjust the resulting P-values for controlling the false-discovery rate. The transcripts having a false-discovery rate of < 0.05 were considered as differentially expressed.	WBPaper00053368:F.oxysporum_regulated
	Transcripts that showed significantly decreased expression in mrps-5(RNAi) animals comparing to animals injected with empty vector.	Differential expression was assessed using a Partial least-squares discriminant analysis (PLS-DA) using mixomics setting a variable of importance (VIP) score of greater than 1 as significant.	WBPaper00059328:mrps-5(RNAi)_downregulated_mRNA
	Transcripts that showed significantly decreased expression in spc-1(cas971) comparing to in N2 at L1 larva stage.	DESeq2, fold change >= 2, FDR <= 0.05	WBPaper00057041:spc-1(cas971)_downregulated
	Transcripts that showed significantly increased expression in drh-3(rrr2) comparing to in N2.	edgeR, log2 fold change > 2 or < -2.	WBPaper00053888:drh-3(rrr2)_upregulated
	Coexpression clique No. 282, srj-21-srh-32, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:srj-21-srh-32
	C-lineage related expression profile.	QT clustering	WBPaper00025032:cluster_18

9 Expression Patterns

• Primary Identifier: Expr6467
• Remark: Also expressed in (comments from author) : PHA phasmid neuron (Thomas Lab, 2005). Embryo incomplete. To be updated. Strain: BC12256
• Reporter Gene: [srb-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCCAAAACTGCTGAACTT] 3' and primer B 5' [CGTCGCAGTCATTCATTTTTATT] 3'.
• Pattern: Adult Expression: pharynx; Nervous System; tail neurons; phasmids; unidentified cells in head; unidentified cells in tail ; Larval Expression: unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr15414

• Primary Identifier: Expr299
• Remark: Data modified according to Shawn Lockery's expression pattern curations.
• Pattern: ADL ADFf ASH PHx

• Primary Identifier: Marker116
• Pattern: Marker for ADL neurons.

• Primary Identifier: Expr3411
• Remark: Reporter gene fusion type not specified.
• Pattern: gmIs12 animals contain only two GFP expressing cells, one PHA and one PHB, on each side of the tail.

• Primary Identifier: Chronogram767
• Remark: Original chronogram file: chronogram.1805.xml
• Reporter Gene: [R05H5.6:gfp] transcriptional fusion.

• Primary Identifier: Expr1024130
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1155041
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2016186
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

8 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00005071
• Start: 10194905
• End: 10196835
• Strand: 1

8 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1931

1 Sequence Ontology Term