WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00005166 Gene Name  srg-8
Sequence Name  ? T12A2.9 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable transmembrane signaling receptor activity. Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane. Biotype  SO:0001217
Genetic Position  III :-1.40776 ±7.8e-05 Length (nt)  ? 1285
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00005166

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:T12A2.9.1 T12A2.9.1 951   III: 6253553-6254837
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:T12A2.9 T12A2.9 951   III: 6253553-6253667

7 RNAi Result

WormBase ID
WBRNAi00053141
WBRNAi00053142
WBRNAi00053163
WBRNAi00005166
WBRNAi00005363
WBRNAi00035489
WBRNAi00035495

15 Allele

Public Name
gk964518
gk176249
gk176250
gk963814
gk963815
cxTi9454
WBVar01645012
gk667659
gk559149
WBVar01939053
gk386455
gk468218
gk646137
gk534123
gk340022

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00005166 6253553 6254837 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

13 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
Temprature shift to 28C for 24 hours. Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 24 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_24h_upregulated
  Genes expressed in embryonic motor neurons (identified by unc-4::GFP expressing cells). Genes called Present by MAS 5.0 in 2 out of 3 unc-4::GFP hybridizations. WBPaper00025141:unc-4::GFP_Expressed_Genes
  Down-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2. Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off. WBPaper00045774:clk-1_downregulated
  Transcripts that showed significantly decreased expression in mex-1(or286) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:mex-1(or286)_downregulated
  Transcripts that showed significantly increased expression in mex-3(eu149) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:mex-3(eu149)_upregulated
  Coexpression clique No. 211, srj-42-srw-113, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:srj-42-srw-113
  Transcripts that showed significantly increased expression after exposure to 0.1ug/L MWCNT from L1 to day 1 adult stage in liquid solutions with OP50. Fold change > 2. WBPaper00057254:MWCNT_downregulated_mRNA

5 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : ASK amphid neuron (Thomas Lab 2005). Low intensity GFP; weakest in adults. Strain: BC11603 [srg-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGCAATGGTACTTCGATATT] 3' and primer B 5' [CGAATAATACAACTGATTTGTGCAT] 3'. Expr6680 Adult Expression: intestine; rectal gland cells; Nervous System; head neurons; Larval Expression: intestine; rectal gland cells; Nervous System; head neurons; amphids; tail neurons;  
Data modified according to Shawn Lockery's expression pattern curations.   Expr301 ASK  
    Expr1026516 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1156758 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
Original chronogram file: chronogram.423.xml [T12A2.9:gfp] transcriptional fusion. Chronogram1552    

5 GO Annotation

Annotation Extension Qualifier
  involved_in
  enables
  located_in
  located_in
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00005166 6253553 6254837 -1

5 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  enables
  located_in
  located_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
1285

1 Sequence Ontology Term