WormMine: Gene WBGene00006746

• WormBase Gene ID: WBGene00006746
• Gene Name: unc-6
• Sequence Name: F41C6.1
• Brief Description: unc-6 encodes a netrin orthologous to the human and mouse netrin-1 precursor proteins; UNC-6 functions as a guidance molecule that regulates circumferential axon migrations as well as migration of mesodermal cells, such as the gonadal distal tip cell, along the dorsoventral axis; in addition, UNC-6 mediates anchor cell (AC) invasion by regulating localization of the UNC-40 netrin receptor to the invasive plasma membrane of the AC, allowing for subsequent formation of an invasive membrane domain; a secreted molecule, UNC-6 is first expressed during embryogenesis in ventral epidermoblasts; additional expression is seen in neurons and sheath cells; UNC-6 is involved in both attractive and repulsive interactions mediated by the UNC-40 and UNC-5 netrin receptors, respectively.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable signaling receptor binding activity. Involved in several processes, including axon guidance; regulation of locomotion; and sex differentiation. Acts upstream of or within dendrite morphogenesis. Located in axon; basement membrane; and cytoplasm. Expressed in several structures, including P1; VA12; accessory cell; interneuron; and somatic neurons. Human ortholog(s) of this gene implicated in congenital mirror movement disorder. Is an ortholog of human NTN1 (netrin 1).
• Biotype: SO:0001217
• Genetic Position: X :-2.07556 ±0.040208
• Length (nt): 7474

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006746

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F41C6.1.1	F41C6.1.1	2424	X: 6889674-6897147
Transcript:F41C6.1.2	F41C6.1.2	2228	X: 6889674-6897140

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F41C6.1	F41C6.1	1839	X: 6889740-6889817

13 RNAi Result

• WBRNAi00089738
• WBRNAi00067172
• WBRNAi00046965
• WBRNAi00027329
• WBRNAi00014732
• WBRNAi00025457
• WBRNAi00025458
• WBRNAi00027616
• WBRNAi00086087
• WBRNAi00078064
• WBRNAi00089927
• WBRNAi00090087
• WBRNAi00090245

130 Allele

• gk964260
• WBVar01927064
• WBVar01927065
• gk962713
• r964
• rh46
• rh69
• rh83
• rh202
• rh1035
• gk547197
• gk549463
• WBVar02064473
• WBVar02064474
• WBVar02064475
• gk862999
• gk644984
• gk798917
• gk576348
• gk376761
• gk562052
• gk792632
• gk319743
• gk857723
• gk335302
• gk918759
• gk779846
• gk517077
• gk379787
• gk565448

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006746
• Start: 6889674
• End: 6897147
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_6897148..6898104
• Length (nt): 957
• Chromosome Location: X: 6897148-6898104
• Organism: Caenorhabditis elegans

186 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_larva_enriched
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Top 300 transcripts enriched in excretory duct, excretory pore according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Excretory_duct_and_pore
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals.	Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed.	WBPaper00062193:skn-1(RNAi)_upregulated
	Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage.	DESeq v1.6.3. Fold change > 1.5.	WBPaper00050370:dpy-21(e428)_L3_upregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated

14 Expression Patterns

• Primary Identifier: Expr6024
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13558
• Reporter Gene: [unc-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGATGTTTGGAAGGATGAATAAT] 3' and primer B 5' [TGTGTGAAAGGGTGTAAAGTGG] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; unidentified cells in head; Larval Expression: stomato-intestinal muscle; anal depressor muscle; body wall muscle; unidentified cells in head

• Primary Identifier: Expr9253
• Remark: The general distribution pattern of Venus::UNC-6 in the wild-type genetic background was similar to that of 3xHA-tagged UNC-6, reported previously (Wadsworth et al. 1996), except for an additional observation of Venus::UNC-6 expression in P6.p descendants, ventral muscle, dorsal muscle in the tail, and in the ray of the male tail. These differences were probably due to the different fixation methods used.
• Pattern: Venus::UNC-6 was mainly detected in ventral cells, including epidermoblasts, glia, neurons, muscle cells, and vulval precursor cells. Venus::UNC-6 was detected in dorsal muscle cells in the tail. In male worms, Venus::UNC-6 was expressed in the ray.

• Primary Identifier: Expr1590
• Pattern: Early Expression by Ventral Epidermoblasts: Ventral epidermoblasts P1/2-P11/12 are the first cells to express UNC-6::HA during embryogenesis. Netrin becomes detectable in the cytoplasm of these twelve cells soon after their births (circa 230 min) and before they form into regular rows. This staining gradually decreases in intensity as the cells spread ventrally, forming two symmetrical rows. At the completion of neurulation, soon after these rows have come together along the ventral midline, cytoplasmic staining is no longer detectable. Expression by Larval Ventral Cord Motorneurons: Postembryonic motorneurons VA2 to VA12 and VB3 to VB11 express UNC-6::HA in the ventral nerve cord. Netrin becomes detectable in these cells soon after their births at the end of the first larval stage. This expression continues through the adult stage. After hatching, the C. elegans larva increases about 5-fold in both length and circumference before becoming an adult. Six axons (AVAL, AVAR, AVBL, AVBR, AVG, and PVQR) in the right longitudinal tract and one axon (PVQL) in the left tract provide a continuous source of UNC-6 in the ventral nerve cord. Near the end of the first larval stage, the twenty postembryonic motorneurons (VA2VA12, VB3VB11) provide a further source of UNC-6 in the right tract. These motorneurons could maintain and sharpen the proposed gradient of netrin in the basement membrane of the epidermis and skew its peak farther to the right of the ventral midline. Expression by Lateral Ring and Lumbar Ganglia Neurons: Paired neurons AVA, AVB, and PVQ express UNC-6::HA in the lateral and lumbar ganglia, respectively. Born circa 300 min, netrin does not become detectable in these cells until about 3-fold elongation. Netrin expression then continues through the larval and adult stages. After axogenesis begins, PVQ itself expresses UNC-6. Expression by Midline and Asymmetric Neurons in the Developing Nerve Cord: Positioned at the anterior and posterior ends of the developing ventral nerve cord, respectively, the midline neurons AVG and PVT express UNC-6::HA. Netrin becomes detectable in the PVT neuron soon after its birth (circa 290 min). At this time, PVT is positioned on the ventral midline of the body wall just anterior to the developing rectum. Netrin expression is transient; UNC-6::HA is no longer detectable in this cell by 3-fold elongation. By then, PVT has shifted to its mature position as the most anterior cell in the preanal ganglion. Born circa 290 min, AVG does not express UNC-6::HA until about 3-fold elongation. AVG is positioned on the ventral midline in the retrovesicular ganglion at this time. Netrin expression then continues through the larval and adult stages. Besides AVG, a second neuron in the retrovesicular ganglion, RIFL (born circa 410 min), also expresses UNC-6::HA from about 3-fold elongation through adult. Interestingly, no UNC-6::HA expression is ever observed in the bilateral homolog RIFR. Expression by Sheaths in the Developing Head: All six inner labial and both ventral cephalic sheaths express UNC-6::HA in the early neurula. Netrin becomes detectable in these cells soon after their births (circa 310 min). At this time, the inner labial sheaths are clustered together just anterior to the developing pharynx. As the head depression forms around comma stage, the cell bodies move anteriorly toward the sensillar rudiments, revealing processes trailing back to the developing nerve ring. The endfeet form a more-or-less complete path around the pharynx that anticipates the anterior margin of the nerve ring. UNC-6::HA is detectable along the entire cell body and process at this time. As the embryo elongates, the cell bodies initially stay near the sensillar rudiments at the tip of the head. Presently, as judged by UNC-6::HA staining, the processes no longer reach the developing nerve ring. By inference, they fail to stretch apace with the rapid elongation of the head. As the pharynx elongates, the cell bodies assume their mature positions, typically just anterior or posterior to the metacorpus. Netrin expression is transient; only weak staining of UNC-6::HA is detectable in these cells beyond 3-fold elongation. The sheath processes appear to provide a scaffold of netrin-labeled pathways that support and guide labial axons to the nerve ring. Moreover, their endfeet could form a ring-shaped substratum for axons within the ring itself. The cephalic sheaths are positioned dorsally and ventrally just anterior to the developing nerve ring. In the early neurula, these cells extend sheetlike processes that apparently anticipate the outer surface of the ring neuropil. At this time, UNC-6::HA is detectable throughout the cell body and processes of the ventral cephalic sheaths. Netrin expression is transient; UNC-6::HA is no longer detectable in these cells by 3-fold elongation. Finally, no UNC-6::HA expression is ever observed in the dorsal cephalic sheaths. Expression by a Midline Neuron in the Developing Pharynx: The midline neuron I5 expresses UNC-6::HA in the developing pharynx. Netrin becomes detectable in this cell soon after its birth (circa 280 min). Positioned on the ventral midline, I5 is the most posterior neuron in the pharynx at this time. Netrin expression is transient; UNC-6::HA is no longer detectable in the cell body after about 3-fold elongation, but staining in the axons persists somewhat longer.

• Primary Identifier: Expr13724
• Pattern: Using a fosmid-based reporter transgene, the previously reported expression of unc-6 in the AVG neuron up to early larval stages was corroborated. However, the expression in the AVG neurons of hermaphrodites begins to fade during the L3 stage, before sexual maturation, and is undetectable by the young adult stage. In contrast, expression is maintained in males during sexual maturation in the L4 stage into the young adult stage. Non-dimorphic unc-6 expression is observed in other neuron classes, some of which maintain unc-6 expression into adulthood (e.g., RIF neurons), whereas others do not (e.g., AVA neurons). Consistent with the expression pattern of the fosmid reporter, we observed robust unc-6 mRNA signals (single molecule FISH) in both sexes of first larval stage animals and strongly sexually dimorphic levels during sexual maturation in the L4 stage.

• Primary Identifier: Expr13722
• Pattern: Using a fosmid-based reporter transgene, the previously reported expression of unc-6 in the AVG neuron up to early larval stages was corroborated. However, the expression in the AVG neurons of hermaphrodites begins to fade during the L3 stage, before sexual maturation, and is undetectable by the young adult stage. In contrast, expression is maintained in males during sexual maturation in the L4 stage into the young adult stage. Non-dimorphic unc-6 expression is observed in other neuron classes, some of which maintain unc-6 expression into adulthood (e.g., RIF neurons), whereas others do not (e.g., AVA neurons). Consistent with the expression pattern of the fosmid reporter, we observed robust unc-6 mRNA signals (single molecule FISH) in both sexes of first larval stage animals and strongly sexually dimorphic levels during sexual maturation in the L4 stage.

• Primary Identifier: Expr13723
• Pattern: Using a fosmid-based reporter transgene, the previously reported expression of unc-6 in the AVG neuron up to early larval stages was corroborated. However, the expression in the AVG neurons of hermaphrodites begins to fade during the L3 stage, before sexual maturation, and is undetectable by the young adult stage. In contrast, expression is maintained in males during sexual maturation in the L4 stage into the young adult stage. Non-dimorphic unc-6 expression is observed in other neuron classes, some of which maintain unc-6 expression into adulthood (e.g., RIF neurons), whereas others do not (e.g., AVA neurons). Consistent with the expression pattern of the fosmid reporter, we observed robust unc-6 mRNA signals (single molecule FISH) in both sexes of first larval stage animals and strongly sexually dimorphic levels during sexual maturation in the L4 stage.

• Primary Identifier: Expr1150827
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2036036
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr8561
• Remark: Picture: Fig. 2a, b.
• Subcellular Localization: In addition to previously reported expression (see Expr1590), low levels of full-length Venus::UNC-6 were observed in the basement membrane under the AC, probably originating from the VNC.

• Primary Identifier: Expr1032820
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr14553
• Pattern: We found that at the early L1 larval stage, the unc-6 reporter is expressed in several cells in the head but not in ALA neurons.

• Primary Identifier: Chronogram678
• Remark: Original chronogram file: chronogram.1707.xml
• Reporter Gene: [F41C6.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1010621
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2017900
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

57 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006746
• Start: 6889674
• End: 6897147
• Strand: 1

57 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 7474

1 Sequence Ontology Term