WormMine: Gene WBGene00013111

• WormBase Gene ID: WBGene00013111
• Gene Name: sta-1
• Sequence Name: Y51H4A.17
• Brief Description: sta-1 encodes a protein that is a member of the STAT family of transcription factors; from N- to C-terminus, STA-1 contains conserved coiled-coil, DNA-binding, and SH2 domains, but apparently lacks a conserved amino-terminal oligomerization domain found in other STAT family members; sta-1 activity is required for repressing dauer formation at high temperatures and genetic analyses indicate that STA-1 acts redundantly with some members of the DAF-7/TGF-beta signaling pathway to repress dauer formation, particularly at low temperatures; tyrosine-phosphorylated STA-1 is able to bind a high affinity mammalian STAT binding sequence, and the STA-1 C-terminus can function as a transcriptional activation domain; sta-1 is widely expressed during most life stages, including the dauer stage, and is found in the pharynx, intestine, body wall muscles, and in neurons; STA-1 localizes to both the cytoplasm and the nucleus, with expression in the latter found particularly in some amphid neurons; in some neurons, STA-1 expression appears to be negatively regulated by DAF-7/TGF-beta signaling.
• Organism: Caenorhabditis elegans
• Automated Description: Enables sequence-specific DNA binding activity. Involved in dauer larval development and positive regulation of transcription by RNA polymerase II. Located in cytoplasm and nucleus. Expressed in coelomocyte; head; somatic nervous system; and tail ganglion. Human ortholog(s) of this gene implicated in several diseases, including Alzheimer's disease; autoimmune disease (multiple); carcinoma (multiple); and hematologic cancer (multiple). Is an ortholog of human STAT5A (signal transducer and activator of transcription 5A) and STAT5B (signal transducer and activator of transcription 5B).
• Biotype: SO:0001217
• Genetic Position: IV :15.1793±
• Length (nt): 7153

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00013111

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y51H4A.17c.1	Y51H4A.17c.1	2322	IV: 16664320-16671467
Transcript:Y51H4A.17a.1	Y51H4A.17a.1	2336	IV: 16664320-16671472
Transcript:Y51H4A.17b.1	Y51H4A.17b.1	1704	IV: 16664322-16667552

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y51H4A.17a	Y51H4A.17a	2121	IV: 16664322-16664630
CDS:Y51H4A.17b	Y51H4A.17b	1704	IV: 16664322-16664630
CDS:Y51H4A.17c	Y51H4A.17c	2112	IV: 16664322-16664630

18 RNAi Result

• WBRNAi00057179
• WBRNAi00057180
• WBRNAi00057181
• WBRNAi00057182
• WBRNAi00078879
• WBRNAi00020892
• WBRNAi00020893
• WBRNAi00109624
• WBRNAi00037364
• WBRNAi00109236
• WBRNAi00095191
• WBRNAi00076807
• WBRNAi00065512
• WBRNAi00109333
• WBRNAi00117227
• WBRNAi00065508
• WBRNAi00109527
• WBRNAi00109430

126 Allele

• gk964078
• gk964500
• gk962765
• gk963590
• gk963795
• gk963704
• gk962529
• gk963948
• gk963888
• qa5800
• tm10005
• WBVar01456800
• WBVar02000639
• WBVar01543009
• WBVar01543010
• WBVar01821953
• WBVar01821954
• WBVar01821955
• WBVar00578756
• WBVar01659799
• WBVar01659798
• WBVar01659795
• WBVar01659794
• WBVar01659797
• WBVar01659796
• WBVar01659791
• WBVar01659790
• WBVar01659793
• WBVar01659792
• WBVar01659788

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00013111
• Start: 16664320
• End: 16671472
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

167 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly decreased expression in daf-16(mgDf50) comparing to in N2 at L1 larva stage.	DESeq v1.20.0 was used to analyze differential gene expression. Transcripts with adjusted p-value < 0.05 were considered differentialled expressed.	WBPaper00048971:daf-16(mgDf50)_downregulated_L1
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly increased expression in daf-2(e1370;mes-1(bn84ts) comparing to in mes-1(bn84ts).	DESeq2 was used for differential expression analysis. A BenjaminiHochberg multiple hypothesis-corrected P-value cutoff of 0.05 was used as a significance cutoff.	WBPaper00049368:daf-2(e1370)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Transcripts that showed significantly increased expression in animals with germline-specific inx-14(RNAi) comparing to in aniamls fed with control vector, both exposed to PA14 infection.	DESeq2. Differentially-expressed genes (DEG) were identified based on two criteria: FDR (False discovery rateusing Benjamini-Hochberg adjusted p-values) < 0.01 and absolute value of log2(Fold Change) > 1.	WBPaper00066146:germline-inx-14(RNAi)_upregulated_PA14
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
	Transcripts that showed significantly increased expression in isp-1(qm150) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:isp-1(qm150)_upregulated
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:nuo-6(qm200)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed

12 Expression Patterns

• Primary Identifier: Expr2035099
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr7028
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11412
• Reporter Gene: [Y51H4A.17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTTTCTACGTGTACGTCAGGG] 3' and primer B 5' [CGATGAGCCCATGATGTCT] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; body wall muscle; Nervous System; nerve ring; tail neurons; unidentified cells in head; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; tail neurons; unidentified cells in head

• Primary Identifier: Expr11508
• Pattern: the sta-1 promoter::NLS::GFP reporter gene was widely expressed in a variety of cells and tissues, during most life stages. Specifically, it was expressed at higher levels in pharynx compared to expression levels in other tissues. GFP was also apparent in the entire intestine, marking all nuclei. Fluorescence intensities of GFP appeared weaker in the anterior intestine than in the posterior intestine, but this effect was due largely to the anterior part of the intestine being obscured by the gonad, where no reporter gene expression was observed. GFP expression was also observed in body muscles as well as in most of the nervous system. Among neuronal cells, GFP expression was readily observed in head ganglia, particularly in the posterior ganglia, including the small dorsal ganglion, two lateral ganglia, and ventral ganglion. Similarly, the sta-1 promoter was functional in the two lumbar ganglia, the dorsorectal ganglion of the tail, and the ventral nerve cord. Developmentally, reporter gene expression was first observed in enclosure stage embryos in a variety of cells, and expression persisted throughout embryogenesis, the four larval stages, and the entire adult life span. Neither cell- nor tissue-specific expression pattern changes were observed during development, nor was there any evident modulation of expression level, as judged by fluorescence intensity. Furthermore, GFP expression persisted throughout the dauer larval stage, although GFP expression level decreased significantly, particularly in the pharynx. Similar conclusions concerning expression pattern were suported by analysis of protein distribution by immunofluorescence.

• Primary Identifier: Expr3814
• Remark: Expression pattern in other life stages was not mentioned in the paper.
• Pattern: Immunohistochemical localization using a STA-1-specific antibody readily detected STA-1 protein in pharynx, head ganglia, tail ganglia, ventral nerve cord, embryos, and body muscles.
• Subcellular Localization: A diffuse staining pattern indicate a largely cytoplasmic localization. This pattern of STA-1 accumulation suggests that it is transcriptionally inactive in the majority of tissues in growing animals. In contrast, detailed analysis of immunostaining patterns in the head ganglia revealed a distinct pattern of nuclear STA-1 accumulation in a few neuronal cells, indicative of activation. Confocal immunostaining analysis of head ganglia identified precise nuclear accumulation of STA-1 in select subsets of neurons.

• Primary Identifier: Expr7725
• Remark: Clone: pUL#JRH4F1
• Pattern: Comma stage embryos show expression in anterior and ventral regions. From late embryo to adult there is expression in ventral and dorsal nerve cords as well as two other nerves in the head, lateral to the terminal pharyngeal bulb. Weak expression is seen in the intestine, head muscles and coelomocytes.

• Primary Identifier: Expr11509
• Subcellular Localization: Immunofluorescence using affinity-purified rabbit serum that recognized endogenous STA-1 proteins showed STA-1 protein expression throughout the body of Bristol N2 animals and revealed a distinct immunostaining pattern in head ganglia where STA-1 accumulated in the nuclei of a small subset of neurons.

• Primary Identifier: Chronogram1580
• Remark: Original chronogram file: chronogram.462.xml
• Reporter Gene: [Y51H4A.17:gfp] transcriptional fusion.

• Primary Identifier: Expr1160615
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1014261
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2016951
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1035818
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr14484
• Subcellular Localization: GFP-STA-1 accumulated on chromatin in the nuclei of intestinal cells.

27 GO Annotation

26 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00013111
• Start: 16664320
• End: 16671472
• Strand: 1

27 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in sta-1(ok587) comparing to in N2 at 4 days post L4 adult hermaphrodite stage.	RNA-seq data were aligned to the C. elegans transcriptome WS190 using bowtie2. Counts were obtained from resulting BAM files using BEDTools, and these were used to generate normalized data tables using DESeq. A cutoff of mean 25 normalized reads (normalized according to DESeq negative binomial distribution) for at least one condition was used, and significantly altered genes were selected (DESeq Benjamini-Hochberg multiple-test correction q < 0.1).	WBPaper00053020:sta-1(ok587)_upregulated
	Transcripts that showed significantly decreased expression in sta-1(ok587) comparing to in N2 at 4 days post L4 adult hermaphrodite stage.	RNA-seq data were aligned to the C. elegans transcriptome WS190 using bowtie2. Counts were obtained from resulting BAM files using BEDTools, and these were used to generate normalized data tables using DESeq. A cutoff of mean 25 normalized reads (normalized according to DESeq negative binomial distribution) for at least one condition was used, and significantly altered genes were selected (DESeq Benjamini-Hochberg multiple-test correction q < 0.1).	WBPaper00053020:sta-1(ok587)_downregulated

1 Sequence

• Length: 7153

1 Sequence Ontology Term