WormMine: Gene WBGene00013583

• WormBase Gene ID: WBGene00013583
• Gene Name: ceh-51
• Sequence Name: Y80D3A.3
• Brief Description: ceh-51 encodes a homeodomain transcription factor most closely related to those of NK-2 subfamily proteins containing multiple serine residues in the N-terminus; ceh-51 is expressed in the early MS lineage downstream of TBX-35; TBX-35 directly activates ceh-51 and TBX-35 is sufficient, but not necessary, for ceh-51 activation; activation of ceh-51 in a tbx-35 mutant background is POP-1-dependent; ceh-51(RNAi) results in 47% progeny arresting as uncoordinated L1 arrest and defects in pharyngeal development; CEH-51 by itself has, at most, a weak ability to specify pharynx and CEH-51 is sufficient to specify muscle cell fate and coelomocyte precursors; loss of ceh-51 synergistically enhances the loss of hlh-1, hnd-1, or unc-120 muscle fate phenotypes and reduction in expression of a coelomocyte marker; double mutants analysis reveals that ceh-51 and tbx-35 together account for the majority of normal MS lineage development downstream of MED-1 and MED-2.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Involved in chordate pharyngeal muscle development; mesodermal cell fate specification; and muscle cell fate specification. Located in nucleus. Expressed in several structures, including MSaa; MSap; MSp; MSpa; and MSpp.
• Biotype: SO:0001217
• Genetic Position: V :18.4006 ±0.019185
• Length (nt): 1850

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00013583

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y80D3A.3.1	Y80D3A.3.1	780	V: 18874133-18875982

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y80D3A.3	Y80D3A.3	705	V: 18874133-18874386

4 RNAi Result

• WBRNAi00058551
• WBRNAi00021516
• WBRNAi00037889
• WBRNAi00073405

39 Allele

• gk963271
• gk963489
• gk963304
• gk963809
• gk963637
• WBVar02062895
• gk399910
• gk346262
• gk894898
• gk614592
• gk636542
• WBVar02025606
• WBVar01875804
• WBVar00597459
• WBVar01750452
• WBVar01750453
• WBVar01750450
• WBVar01750451
• WBVar01750449
• WBVar01925378
• WBVar01522654
• tm2123
• WBVar01597245
• tm2187
• WBVar00224839
• WBVar01638796
• WBVar01638797
• WBVar01638794
• WBVar01638795
• WBVar00063276

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00013583
• Start: 18874133
• End: 18875982
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

80 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly decreased expression in lipl-4 overexpression transgenic lines comparing to wild type control animals.	DESeq2 fold change > 2, FDR < 0.05.	WBPaper00064156:lipl-4(overexpress)_downregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure at 25C.	Transcripts that showed significantly increased expression in N2 animals with 24 hours of exposure to P. aeruginosa PA14 for 24 hrs at 25C, comparing to N2 animals without exposure to PA14.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00058948:PA14_upregulated
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva.	Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage.	DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3.	WBPaper00058958:100mGy-irradiation-72h_upregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Transcripts that showed significantly increased expression in BAT525 [hmg-3 (tm2539) / dpy-5(e61) unc-13(e1091) I.] comparing to in N2 at 1-day post L4 adult hermaphrodite stage.	DESeq 2, fold change > 4, adjusted p-value < 0.05.	WBPaper00055013:hmg-3(bar24)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_downregulated
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed significantly increased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_upregulated
	Expression Pattern Group D, enriched for genes involved in catabolic processes.	The significance (P 0.0001) of the relative age (time) was used to determine if a gene was differentially expressed between the three age (time) groups. The effect of this factor explaining gene expression differences was used to determine if the expression went up or down during the two age/time periods (t1 - t2 and t2 -t3). Authors used a permutation approach to determine the thresholds for the different mapping strategies. For each of the used models for eQTL mapping, authors used 23,000 permutations. For each permutation, authors randomly picked a spot; each spot could only be picked once. The gene expression and relative lifespan values were than randomly distributed over the RILs (and time points) and used for mapping. In this way, authors obtained a threshold for each of the explaining factors. For the single time points, authors used a FDR of 0.01 to adjust for multiple testing. The genome-wide threshold for this FDR is -log10 P = 3.8 for each of the three time points. For the combined models (t1 to t2 and t2 to t3), authors used a genome-wide threshold of -log10 P = 4, which resembles an FDR of 0.006, 0.001, and 0.006 for marker, age, and the interaction between marker and age, respectively. To determine the threshold for the single gene examples, authors used 1000 permutations as in the genome-wide threshold. The difference is that they use the gene under study in all of the permutations. The P-values for the gene specific thresholds were determined at FDR = 0.05.	WBPaper00036286:Pattern_D
	Transcripts that showed significantly increased expression in sams-3(RNAi) comparing to N2 animals injected with empty vector.	Deseq FDR < 0.01, fold change > 2.	WBPaper00065005:sams-3(RNAi)_upregulated
	Genes with significantly decreased expression in eat-2(ad465) comparing to N2.	The criteria for differential gene regulation included a greater than 1.5-fold change in expression compared to wild-type, a false discovery rate less than 0.05, and greater than 10 reads when normalized to the base mean. Statistical analysis and drawing of plots was performed in R using the bioconductor package Deseq (Anders, Huber 2010) and R function gplots.	WBPaper00044037:eat-2_downregulated
	Transcripts that showed significantly increased expression in sams-4(RNAi) comparing to N2 animals injected with empty vector.	Deseq FDR < 0.01, fold change > 2.	WBPaper00065005:sams-4(RNAi)_upregulated
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_upregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_upregulated
20C vs 25C	Transcripts that showed differential expression in 20C vs 25C in mir-34(gk437) animals at adult stage.	N.A.	WBPaper00050488:20C_vs_25C_regulated_mir-34(gk437)_adult
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 20C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_20C_upregulated
	Significantly downregulated genes from cyc-1(RNAi) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:cyc-1(RNAi)_downregulated
	Genes that showed significant differential expressed between control and 20 mg\/L Cadmium treatment.	t-test, p < 0.05.	WBPaper00036123:Cadmium_regulated
Bacteria diet: Lb.gasseri	Transcripts that showed significantly decreased expression in animals fed with homofermentative LAB Lb. gasseri, comparing to animals fed with OP50 from day 1 to day 5 adult stage.	fold change > 2 and p value < 0.05 by Students t- test.	WBPaper00065392:Lb.gasseri_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 100uM Psora from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Psora_downregulated
	Transcripts that showed significantly decreased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_downregulated
	Transcripts that showed significantly decreased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_downregulated
	Transcripts that showed significantly decreased expression in mex-1(or286) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	RPKM fold change > 2.	WBPaper00058598:mex-1(or286)_downregulated
	Transcripts that showed significantly increased expression in Day 8 adults comparing to in Day 1 adults in neuron cells.	t-test, fold change > 2, p-value < 0.01.	WBPaper00062590:Aging_upregulated_neuron

15 Expression Patterns

• Primary Identifier: Expr2009891
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr7746
• Remark: Clone: pUL#JRH/AC8
• Pattern: Expression seen only during embryogenesis. Can see 4 cells expressing at the 50 cell stage, and watch further divisions up to 16 cells, after which the pattern becomes complex and is mostly in anterior regions. No expression is seen in 2-fold embryos and later.

• Primary Identifier: Chronogram80
• Remark: Original chronogram file: chronogram.1090.xml
• Reporter Gene: [Y80D3A.3:gfp] transcriptional fusion.

• Primary Identifier: Chronogram93
• Remark: Original chronogram file: chronogram.1101.xml
• Reporter Gene: [Y80D3A.3:gfp] transcriptional fusion.

• Primary Identifier: Chronogram49
• Remark: Original chronogram file: chronogram.1041.xml
• Reporter Gene: [Y80D3A.3:gfp] transcriptional fusion.

• Primary Identifier: Chronogram48
• Remark: Original chronogram file: chronogram.1040.xml
• Reporter Gene: [Y80D3A.3:gfp] transcriptional fusion.

• Primary Identifier: Expr7132
• Remark: Strain: BC15167
• Reporter Gene: [Y80D3A.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAACCGGAAAAGTGCAAAAA] 3' and primer B 5' [TGGAATGAATTGGGGGAAT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; PVT interneuron; Larval Expression: intestine; Nervous System; head neurons; PVT interneuron

• Primary Identifier: Expr8661
• Remark: Picture: Fig 3.
• Pattern: Authors confirmed that ceh-51 transcripts accumulate in the MS daughters and persist into the MS granddaughters, as observed in 91% (n=70) of embryos at the MS2 to MS4 stage. Similar expression was seen with a ceh-51::GFP transcriptional reporter carrying 788 bp of genomic DNA upstream of the predicted ATG, a GFP::CEH-51 translational fusion with 358 bp of upstream region.

• Primary Identifier: Chronogram1115
• Remark: Original chronogram file: chronogram.2238.xml
• Reporter Gene: [Y80D3A.3:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1116
• Remark: Original chronogram file: chronogram.2239.xml
• Reporter Gene: [Y80D3A.3:gfp] transcriptional fusion.

• Primary Identifier: Expr2028131
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1036073
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1027049
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr15594

• Primary Identifier: Expr1161955
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

15 GO Annotation

26 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00013583
• Start: 18874133
• End: 18875982
• Strand: 1

15 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1850

1 Sequence Ontology Term