WormMine: Gene WBGene00015814

• WormBase Gene ID: WBGene00015814
• Gene Name: oatr-1
• Sequence Name: C16A3.10
• Brief Description: C16A3.10 encodes an ornithine transaminase orthologous to the human gene OAT (ornithine aminotransferase); the product of C16A3.10 is predicted to catalyze the conversion of ornithine to L-glutamate-5-semialdehyde in the process of arginine-to-proline conversion.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable identical protein binding activity; ornithine aminotransferase activity; and pyridoxal phosphate binding activity. Predicted to be involved in arginine catabolic process to glutamate and arginine catabolic process to proline via ornithine. Predicted to be located in cytoplasm. Expressed in tail. Used to study amino acid metabolic disorder. Human ortholog(s) of this gene implicated in gyrate atrophy. Is an ortholog of human OAT (ornithine aminotransferase).
• Biotype: SO:0001217
• Genetic Position: III :-1.30449±
• Length (nt): 1947

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00015814

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C16A3.10.2	C16A3.10.2	1456	III: 6394236-6396182
Transcript:C16A3.10.1	C16A3.10.1	1417	III: 6394238-6395935

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C16A3.10	C16A3.10	1269	III: 6394385-6394557

9 RNAi Result

• WBRNAi00040651
• WBRNAi00110479
• WBRNAi00010816
• WBRNAi00005376
• WBRNAi00110480
• WBRNAi00028943
• WBRNAi00110481
• WBRNAi00110478
• WBRNAi00090612

26 Allele

• gk964518
• gk176509
• gk176510
• gk176511
• gk176512
• gk176513
• gk176514
• gk176515
• gk176516
• gk176517
• gk176518
• gk863323
• gk735296
• gk608545
• gk720454
• gk416881
• gk476085
• gk424218
• gk451421
• gk540723
• gk426266
• gk594346
• tm5454
• WBVar01566671
• WBVar00057165
• gk919718

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00015814
• Start: 6394236
• End: 6396182
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_6393845..6394235
• Length (nt): 391
• Chromosome Location: III: 6393845-6394235
• Organism: Caenorhabditis elegans

177 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
Dietary restriction	Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:DietaryRestriction_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:clk-1(qm30)_upregulated
Transgeneration hypoxia treatment.	Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage.	For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR.	WBPaper00064871:hypoxia_upregulated_F1
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated
	Transcripts that showed significantly decreased expression in dissected female germline comparing to in dissected male germline.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:female_vs_male_downregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
Temperature Shift: 4C for 2 hours followed with 20C for 1 hour.	Transcripts that showed significantly decreased expression after animals were exposed to 4C for 2 hours and then recovered at 20C for 1 hour.	DESeq2, adjusted p-value <= 0.05.	WBPaper00054192:cold-shock_downregulated
	Transcripts that showed significantly decreased expression in FACS sorted neuron cells (labelled by pan-neuronal GFP) from edIs6[unc-119::GFP + rol-6(su1006)]; thoc-5(wy822) comparing to in edIs6.	DESeq2, log2 fold change > 2, adjusted p-value < 0.005.	WBPaper00055103:thoc-5(wy822)_downregulated
	Transcripts that showed significantly altered expression in rnp-6(dh1127) animals comparing to in N2 when fed with heat killed E. coli OP50.	Differentially expressed genes (DEGs) (q-value <0.05) between different samples were identified using the stringtie version 1.3.0, followed by Cufflinks version 2.2.	WBPaper00059824:rnp-6(dh1127)_regulated_OP50

10 Expression Patterns

• Primary Identifier: Expr5273
• Remark: Strain: BC10379
• Reporter Gene: [C16A3.10a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGGCTTTTGGTTGCAATTT] 3' and primer B 5' [GAGGGAGGACAAGATTCTGC] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; unidentified cells in tail ; Larval Expression: intestine; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5274
• Remark: Strain: BC11518
• Reporter Gene: [C16A3.10a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGGCTTTTGGTTGCAATTT] 3' and primer B 5' [GAGGGAGGACAAGATTCTGC] 3'.
• Pattern: Adult Expression: hypodermis; Larval Expression: hypodermis

• Primary Identifier: Expr5275
• Remark: Also expressed in (comments from author) : No comments. Strain: BC16196
• Reporter Gene: [C16A3.10b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGAAAAACATGCCGTTCG] 3' and primer B 5' [GGGAGGACAAGATTCTGCAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; hypodermis; Larval Expression: pharynx; intestine; hypodermis

• Primary Identifier: Expr1036771
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1021415
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2032822
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram2045
• Remark: Original chronogram file: chronogram.954.xml
• Reporter Gene: [C16A3.10:gfp] transcriptional fusion.

• Primary Identifier: Expr2014589
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1144706
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram1413
• Remark: Original chronogram file: chronogram.294.xml
• Reporter Gene: [C16A3.10:gfp] transcriptional fusion.

15 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00015814
• Start: 6394236
• End: 6396182
• Strand: -1

15 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins that showed more than 4 fold of expression decrease in orn-1(RNAi) comparing to in control animals.	Proteins with more than 4 fold change in expression level are considered differentially expressed.	WBPaper00040135:orn-1(RNAi)_downregulated
	Proteins that showed more than 4 fold of expression increase in orn-1(RNAi) comparing to in control animals.	Proteins with more than 4 fold change in expression level are considered differentially expressed.	WBPaper00040135:orn-1(RNAi)_upregulated

1 Sequence

• Length: 1947

1 Sequence Ontology Term