WormMine: Gene WBGene00025707

• WormBase Gene ID: WBGene00025707
• Gene Name: Cbr-puf-2
• Sequence Name: CBG02702
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity. Expressed in anchor cell; pm7; and vulval cell. Is an ortholog of C. elegans fbf-1 and fbf-2. In C. elegans, fbf-1 is involved in several processes, including germline cell cycle switching, mitotic to meiotic cell cycle; olfactory learning; and regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02702.1	CBG02702.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02702	CBG02702		[unknown]

0 RNAi Result

5 Allele

• WBVar00035234
• WBVar00107866
• WBVar00107865
• WBVar00107873
• WBVar00107867

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

• Primary Identifier: Expr1062018
• Remark: CBG02702, TTCTGGCAAGAAGATCCTAGACATACTTCAAAGCATGGAAGGCTACGTACCAACCGCCAC, WBGene00025707
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr11516
• Pattern: The developmental profiles of Cbr-puf-2 and Cbr-puf-1.2 mRNA levels are qualitatively similar and are typical of germ line-expressed genes: low expression from embryo to L2 stages, slightly increasing expression at L3 and L4, and peak levels in adults. However, Cbr-puf-2 is over 100-fold more abundant than Cbr-puf-1.2.

• Primary Identifier: Expr11436
• Pattern: Cbr-puf-2 is expressed in the pharyngeal muscle 7. The GFP signal could only be detected during a brief window from the late fourfold embryo to the early second larval stage. Cbr-puf-2 reporter expression is also seen in four vulval muscle (vm) cells starting in L4. It is expressed in the anchor cell and vulval muscles, but not in the vulva precursor cells (VPCs) themselves.

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term