WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00031000 Gene Name  CBG09413
Sequence Name  ? CBG09413 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable sequence-specific DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus. Is an ortholog of C. elegans dmd-10. In C. elegans, dmd-10 is involved in several processes, including male anatomical structure morphogenesis; mechanosensory behavior; and negative regulation of synapse pruning. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG09413a.1 CBG09413a.1   [unknown]
Transcript:CBG09413b.1 CBG09413b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG09413a CBG09413a   [unknown]
CDS:CBG09413b CBG09413b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_upregulated

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG09413, CCAGAAGCTCATGGCTGATCAGATCAAGATTCGTCGTCGTCAACGAAAGGATACATTGAT, WBGene00031000   Expr1051204 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG09411, TTGGTTGAGAAGCGGCGAATCTTGAATATCCGACTTCAGAACTACAATACGCCCAATGAA, WBGene00030999   Expr1051500 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

3 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in
  located_in

0 Homologues

0 Locations

3 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in
  located_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term