Genomics
2 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG09413a.1 | CBG09413a.1 | [unknown] | |
Transcript:CBG09413b.1 | CBG09413b.1 | [unknown] |
Other
2 CDSs
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
CDS:CBG09413a | CBG09413a | [unknown] | |
CDS:CBG09413b | CBG09413b | [unknown] |
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
2 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG09413, CCAGAAGCTCATGGCTGATCAGATCAAGATTCGTCGTCGTCAACGAAAGGATACATTGAT, WBGene00031000 | Expr1051204 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
CBG09411, TTGGTTGAGAAGCGGCGAATCTTGAATATCCGACTTCAGAACTACAATACGCCCAATGAA, WBGene00030999 | Expr1051500 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |