WormMine: Gene WBGene00031056

• WormBase Gene ID: WBGene00031056
• Gene Name: Cbr-shw-3
• Sequence Name: CBG09488
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable voltage-gated potassium channel activity. Predicted to be involved in potassium ion transport; protein homooligomerization; and transmembrane transport. Predicted to be located in membrane. Predicted to be part of voltage-gated potassium channel complex. Is an ortholog of C. elegans shw-3. In C. elegans, shw-3 is involved in potassium ion transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09488b.1	CBG09488b.1		[unknown]
Transcript:CBG09488a.1	CBG09488a.1		[unknown]
Transcript:CBG09488d.1	CBG09488d.1		[unknown]
Transcript:CBG09488c.1	CBG09488c.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09488c	CBG09488c		[unknown]
CDS:CBG09488d	CBG09488d		[unknown]
CDS:CBG09488a	CBG09488a		[unknown]
CDS:CBG09488b	CBG09488b		[unknown]

0 RNAi Result

1 Allele

• WBVar00011052

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070087
• Remark: Cbr-shw-3, ATTCCAGAGTTACAGCTATTCGGAAACTTTTCTCGCAATCATCGAAGTATTTCTTCACGA, WBGene00031056
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term